Busch Lab

ZMP

zgc:193790

Ensembl ID:
ENSDARG00000075084
ZFIN ID:
ZDB-GENE-080723-55
Description:
Zgc:193790 [Source:UniProtKB/TrEMBL;Acc:B3DG10]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa43561 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43561
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113459 Nonsense 279 288 3 3
ENSDART00000124330 Nonsense 279 288 2 2
ENSDART00000135777 Nonsense 312 321 3 3
Genomic Location (Zv9):
Chromosome 21 (position 2562109)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2310626
GRCz11 21 2336450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTCAGTGCGGGAGGAGCTTCTCTCGGTTGTCATCCTTGACGAATCAT[C/T]AGAGAGTTCATACTAGAGTGAACAAAAAGTGATGATGTTTTGTTTAATGC
Long Flanking Sequence:
ACAGGAGGGTCCACACCGGAATGAAGCCTTTTAATTGCAAGCACTGCAGGAAGAGTTTCACAAGTAAAGGCGCTCTCAGACACCACCTGCGCTCTCACACTGATAAAAAGCCATTTAGTTGTAGTCACTGCGATAAAACGTTTCTGACAAAAGCTCTATTAAAGCGACACCTGGTTGTTCATACTGCTGCCAAGCCTCATGCTTGCTCTGTTTGCGGAAATACCTTTTTATACCTGCAGAAGTTGAAAGTGCACGAGCTTATTCACACCGGAGAGAAGCCTCACAAGTGCTCGGACTGTGGGAAGAGCTTCAGAACATCAAGCAACCTTAAAATACACCAGAGGATTCACACCGGAGAGAAACCGCATCAGTGTTCGGACTGCGAGAAGAGCTACCCTACTTCGTCAGCTTTGAAGGTTCATCAGAAATCGCACAATAGAGTAATCGTGTGCTCTCAGTGCGGGAGGAGCTTCTCTCGGTTGTCATCCTTGACGAATCAT[C/T]AGAGAGTTCATACTAGAGTGAACAAAAAGTGATGATGTTTTGTTTAATGCATTGGTGCATTAAACAAAACGTTACTAGATATCTTGGAAACGTCCTTGCAGGTGTGTTTAGGCAAGTCGGAGCTATATTCGAAGGACACCGGCCCTCTAGAACCGATTTTGGACATCCCTGTGTTATGTTGTTAATGTATTGGTTGCACAAACTTGTTTTTCTCATTTTATGCTTTAGCTGCGCTGCCATCTAGTGGTTAATGTTTATGATCGAGCCTTCGCCTCTGGCTTTATGAATGTTACTTTTGAGAAAATGTTTGCATTAAGCACAATTGATTATTGACTAAATGGTATTTAAGAGGACAAAAGGGCCAGTGTCATGGAGAGTTTAGCTCCAACCCTAATCAAACACACCTGAACCAGCTAATCAAACCCTTACTACATAGGTGTCAAAGTCAATTTCTGGAGAGCCGCAGCTCTGCACAGTTTTGCTCCAACTCTATTCCAACA
Associated Phenotype:
Not determined