Busch Lab

ZMP

wu:fa96e12

Ensembl ID:
ENSDARG00000075083
ZFIN ID:
ZDB-GENE-030131-9008
Human Orthologue:
AC103686.1
Human Description:
DNA-dependent protein kinase catalytic subunit [Source:UniProtKB/Swiss-Prot;Acc:P78527]
Mouse Orthologue:
Prkdc
Mouse Description:
protein kinase, DNA activated, catalytic polypeptide Gene [Source:MGI Symbol;Acc:MGI:104779]

Alleles

There are 20 alleles of this gene:

Allele Name Consequence Status Availability
sa978 Essential Splice Site Available for shipment Available now
sa40977 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13311 Nonsense Available for shipment Available now
sa21046 Nonsense Available for shipment Available now
sa903 Essential Splice Site Available for shipment Available now
sa45289 Nonsense Mutation detected in F1 DNA Not yet available
sa45288 Nonsense Mutation detected in F1 DNA Not yet available
sa12418 Nonsense Available for shipment Available now
sa27016 Nonsense Mutation detected in F1 DNA Not yet available
sa7082 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17162 Nonsense Available for shipment Available now
sa13548 Essential Splice Site Available for shipment Available now
sa16262 Nonsense Available for shipment Available now
sa34148 Nonsense Available for shipment Available now
sa21045 Nonsense Available for shipment Available now
sa40976 Nonsense Mutation detected in F1 DNA Not yet available
sa34147 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa978
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 148 4119 4 86
ENSDART00000051679 Essential Splice Site 148 4119 4 86
Genomic Location (Zv9):
Chromosome 7 (position 44124381)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41114681
GRCz11 7 41394754
KASP Assay ID:
554-0883.1 (used for ordering genotyping assays)
KASP Sequence:
AGGACAAATCTGCAAAGTGCAGAAATCCTGCTTTAGATCTTCTAATCAAA[G/T]TGAGTTCTTTTGTTTATATATTGTATGAATCTGACTCGAGACTTTGATGT
Long Flanking Sequence:
ATCTTTGCTCTTTGCAAAGGAAGAGGGATTGCTTAGCTTTCTTCGCAGGTCTCTGTCTACTGAAAAGGTAGGAGGAATTTAACTAATAAATGACATTTATATTATTTCAGAAGGATTTACCAGATTGCAATCTAATTTTATTAATATGAAATTGCTTAAATGGATTTTCTGCAGCTGGGGACTACAGGAGTGGAGATTCTGCGGGAAACGAGAGTGGAGATTATGAATTTCTTAGGGGCATTTCTACAGAGAATGTCAGCCACTGTCCGAGGATGGGAAAAGAACTATGCTGTCGAGCTTAAGGTACCTTTATCCTATCGTTTAATTAATGTGAATTAATGTGACTGCCAGCACTGACATGTCATCTTTGTTGCACTAGTTTAATTTGCTTGATTTTTTTTTTTTGTTTCTCTCTGCGTGAATAGGACACGTGCATTGTCGTTTACACAAAGGACAAATCTGCAAAGTGCAGAAATCCTGCTTTAGATCTTCTAATCAAA[G/T]TGAGTTCTTTTGTTTATATATTGTATGAATCTGACTCGAGACTTTGATGTTTATCCAACTGAGGTATGTCAGGATAGTTCTCTACATATCATAATAAAAGGTAGTCAGATAATTGTAAGCATGTCTGCTGATGCTGTTATTTCTATACATATATTGATAGTTAGGGCTGTGAAATATGGCAATATATATTAAAAAGTCTATACTGTAGTATCATATTATGCTCTACGCCAGGGGTGGCCAACCCTGTTCCTGGAGAGCCACCTTCCTGCAGATTTCAGTTGCTACCTATATCAAACACACCTGAACCAATTAAGGCCCCGTTTACACTAGTGCGTTTTAGTTTGAAAACGTATAAGTTTTGCTACGGTTACGCCATCCGTCCACACTATGCCGGAGTTCTCGAGCGCCGAAAACGGAGCTTTTTGAAAACGCTGGAGAGGCCGTTTTCATTCTAAAACGCTGCTGCTCCGTCTCAGTGTGGATGGGGAAAGACGGAGACA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40977
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 148 4119 4 86
ENSDART00000051679 Essential Splice Site 148 4119 4 86
Genomic Location (Zv9):
Chromosome 7 (position 44124381)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41114681
GRCz11 7 41394754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGACAAATCTGCAAAGTGCAGAAATCCTGCTTTAGATCTTCTAATCAAA[G/A]TGAGTTCTTTTGTTTATATATTGTATGAATCTGACTCGAGACTTTGATGT
Long Flanking Sequence:
ATCTTTGCTCTTTGCAAAGGAAGAGGGATTGCTTAGCTTTCTTCGCAGGTCTCTGTCTACTGAAAAGGTAGGAGGAATTTAACTAATAAATGACATTTATATTATTTCAGAAGGATTTACCAGATTGCAATCTAATTTTATTAATATGAAATTGCTTAAATGGATTTTCTGCAGCTGGGGACTACAGGAGTGGAGATTCTGCGGGAAACGAGAGTGGAGATTATGAATTTCTTAGGGGCATTTCTACAGAGAATGTCAGCCACTGTCCGAGGATGGGAAAAGAACTATGCTGTCGAGCTTAAGGTACCTTTATCCTATCGTTTAATTAATGTGAATTAATGTGACTGCCAGCACTGACATGTCATCTTTGTTGCACTAGTTTAATTTGCTTGATTTTTTTTTTTTGTTTCTCTCTGCGTGAATAGGACACGTGCATTGTCGTTTACACAAAGGACAAATCTGCAAAGTGCAGAAATCCTGCTTTAGATCTTCTAATCAAA[G/A]TGAGTTCTTTTGTTTATATATTGTATGAATCTGACTCGAGACTTTGATGTTTATCCAACTGAGGTATGTCAGGATAGTTCTCTACATATCATAATAAAAGGTAGTCAGATAATTGTAAGCATGTCTGCTGATGCTGTTATTTCTATACATATATTGATAGTTAGGGCTGTGAAATATGGCAATATATATTAAAAAGTCTATACTGTAGTATCATATTATGCTCTACGCCAGGGGTGGCCAACCCTGTTCCTGGAGAGCCACCTTCCTGCAGATTTCAGTTGCTACCTATATCAAACACACCTGAACCAATTAAGGCCCCGTTTACACTAGTGCGTTTTAGTTTGAAAACGTATAAGTTTTGCTACGGTTACGCCATCCGTCCACACTATGCCGGAGTTCTCGAGCGCCGAAAACGGAGCTTTTTGAAAACGCTGGAGAGGCCGTTTTCATTCTAAAACGCTGCTGCTCCGTCTCAGTGTGGATGGGGAAAGACGGAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13311
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1035 4119 27 86
Genomic Location (Zv9):
Chromosome 7 (position 44112872)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41103172
GRCz11 7 41383245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCGTAATKATGTACTTTTTKGWTACATAGGATGGGATTGTGGATCCAT[T/A]GGACAGCACCCTCAGAGACTTCAGTGGCACCTGCATCCAGGAATTTGTCA
Long Flanking Sequence:
TTATAATATGGATGTCAATGCTTATTGGTTTTCAATAATCTTCTGTATATATTCCTTTGTGTTCAACAGAAGAAAGAAACTTGAACAGTTTTAGAAACAATTAAATTTACAATGAAATGCATATAATATTTTAAATTATTGATTTATTACCTAACACTTTACTGTTTAGCTCAGTGTTTTTGTGATAATTAAGTTGTTTATGTTTTGTTTTTTGAAATAATGTTTGCTTTAAGTTGCACATACTAACATTAATAGAAATGTAAGTAAGAAGTCGGTCATTTGAATGTTTCTTTAGGTGACGCGGCAACTCTTTGAGCCTCTGGTGATGCAGCTTATCCACTGGTTCACCAACAATCGAAAGTTTGAGAGCCAAGACACAGTGGCAGTGCTGGAGGCCATCCTGGTAAGCAGGCATGTGCAATTGCACTTTTTGTTTGCTGTGGAAACATTTGCCGTAATGATGTACTTTTTTGTTACATAGGATGGGATTGTGGATCCAT[T/A]GGACAGCACCCTCAGAGACTTCAGTGGCACCTGCATCCAGGAATTTGTCAAATGGTCTATCAAACAGACCACCCCCAAACAGCAGGAAAAGAGCCCGGCCAACATGAAATCCCTCTTCAAGCGTATCTACAGCTTGGCTTTACACCCCAGTGTCTTCAAGAGGCTTGGAGCTGCGCTGGCCTTTAACAGCATGTACAGGCAGTTCAGGTCTGTGTATGATGAGGACGAGATCTCATTATGGGCTTCTCAACATTTAAATAAATATGTCTTGAGTGGATGTTGGTAACAAATTTAAATCTCATGTGTTTTTCCTCAGGGAAGAGAGCTCTTTGGTTGAGCAGTTTGTCTTCGAGGTGCTGGTGGTGTTTGTTGAGAGTTTGGCTTTGGCCCACTTTGATGAAAAGTCTGTGGGTAAGAAACTGGACCACTATCAAGATATCCTTTCAGATGGTTATGACCGTGATCTTTACATGATATTTGGCTTCTGTTTATACAGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21046
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1063 4119 27 86
Genomic Location (Zv9):
Chromosome 7 (position 44112789)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41103089
GRCz11 7 41383162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATCCAGGAATTTGTCAAATGGTCTATCAAACAGACCACCCCCAAACAG[C/T]AGGAAAAGAGCCCGGCCAACATGAAATCCCTCTTCAAGCGTATCTACAGC
Long Flanking Sequence:
AACAGTTTTAGAAACAATTAAATTTACAATGAAATGCATATAATATTTTAAATTATTGATTTATTACCTAACACTTTACTGTTTAGCTCAGTGTTTTTGTGATAATTAAGTTGTTTATGTTTTGTTTTTTGAAATAATGTTTGCTTTAAGTTGCACATACTAACATTAATAGAAATGTAAGTAAGAAGTCGGTCATTTGAATGTTTCTTTAGGTGACGCGGCAACTCTTTGAGCCTCTGGTGATGCAGCTTATCCACTGGTTCACCAACAATCGAAAGTTTGAGAGCCAAGACACAGTGGCAGTGCTGGAGGCCATCCTGGTAAGCAGGCATGTGCAATTGCACTTTTTGTTTGCTGTGGAAACATTTGCCGTAATGATGTACTTTTTTGTTACATAGGATGGGATTGTGGATCCATTGGACAGCACCCTCAGAGACTTCAGTGGCACCTGCATCCAGGAATTTGTCAAATGGTCTATCAAACAGACCACCCCCAAACAG[C/T]AGGAAAAGAGCCCGGCCAACATGAAATCCCTCTTCAAGCGTATCTACAGCTTGGCTTTACACCCCAGTGTCTTCAAGAGGCTTGGAGCTGCGCTGGCCTTTAACAGCATGTACAGGCAGTTCAGGTCTGTGTATGATGAGGACGAGATCTCATTATGGGCTTCTCAACATTTAAATAAATATGTCTTGAGTGGATGTTGGTAACAAATTTAAATCTCATGTGTTTTTCCTCAGGGAAGAGAGCTCTTTGGTTGAGCAGTTTGTCTTCGAGGTGCTGGTGGTGTTTGTTGAGAGTTTGGCTTTGGCCCACTTTGATGAAAAGTCTGTGGGTAAGAAACTGGACCACTATCAAGATATCCTTTCAGATGGTTATGACCGTGATCTTTACATGATATTTGGCTTCTGTTTATACAGGAACTGTCCAGCAGTGTTGTAGTTCACTGGATCATTTGAAGAGAATCATCAAACACAAGGCAGACTCACTAAATATAAACTCCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa903
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 1136 4119 28 86
Genomic Location (Zv9):
Chromosome 7 (position 44112459)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41102759
GRCz11 7 41382832
KASP Assay ID:
554-0810.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTTTGTTGAGAGTTTGGCTTTGGCCCACTTTGATGAAAAGTCTGTGGG[T/G]AAGAAACTGGACCACTATCAAGATATCCTTTCAGATGGTTATGACCGTGA
Long Flanking Sequence:
ATGTGCAATTGCACTTTTTGTTTGCTGTGGAAACATTTGCCGTAATGATGTACTTTTTTGTTACATAGGATGGGATTGTGGATCCATTGGACAGCACCCTCAGAGACTTCAGTGGCACCTGCATCCAGGAATTTGTCAAATGGTCTATCAAACAGACCACCCCCAAACAGCAGGAAAAGAGCCCGGCCAACATGAAATCCCTCTTCAAGCGTATCTACAGCTTGGCTTTACACCCCAGTGTCTTCAAGAGGCTTGGAGCTGCGCTGGCCTTTAACAGCATGTACAGGCAGTTCAGGTCTGTGTATGATGAGGACGAGATCTCATTATGGGCTTCTCAACATTTAAATAAATATGTCTTGAGTGGATGTTGGTAACAAATTTAAATCTCATGTGTTTTTCCTCAGGGAAGAGAGCTCTTTGGTTGAGCAGTTTGTCTTCGAGGTGCTGGTGGTGTTTGTTGAGAGTTTGGCTTTGGCCCACTTTGATGAAAAGTCTGTGGG[T/G]AAGAAACTGGACCACTATCAAGATATCCTTTCAGATGGTTATGACCGTGATCTTTACATGATATTTGGCTTCTGTTTATACAGGAACTGTCCAGCAGTGTTGTAGTTCACTGGATCATTTGAAGAGAATCATCAAACACAAGGCAGACTCACTAAATATAAACTCCAAGAGACGGATACCCAGGTGCACATGCATATATATATTTTTAATTTAATTAAGTTTTATTAAAAATAATAAAAATAAACTTTTTTTGTAACTGTTAATCTTCCAACCCACAACAATTCCTTGATTGCAGACATATATACATTTAGGTTATATTAGGGAAAATGTATATTTAAGTTATATTATGGGAAATAATATTTATGTATTTAATATAAAGGATATTATTGATATAATTATTTATTTATTTTTATTTGTTTTGTTTTTTTTACTTGTGAGTAATGAAAAGAATTTGTGTGGTTTTGTGGCGAGCTGACAGAGCTGTGTTTTCTCCTCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45289
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1815 4119 41 86
Genomic Location (Zv9):
Chromosome 7 (position 44105935)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41096235
GRCz11 7 41376308
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTCTTATTTGGGAAAACAAGTTCTTCTCCTCAGCTCCACCTACCAAT[C/A]ATTTCAAGCCAAAGAAGTTCCATCAAACTTCATGCTCATGGGTCTGATAG
Long Flanking Sequence:
TTCACTGCATTGCCCAGCATGCCTTTAGAGGAGCTCAGGAGGGCTCTGGAGTCACTGGTGGCTACACATTTCCCTATGCAGTCAGATGAATTTCCACGTGGATCTCTACAGTGCAACAACTACATGGATTGCATTCGCAAGGTGAGATATAAGGGGACCTGAAGATATTATTATTATTATTTTTAAATAGTTTTATTTCCATATTTATGTCAATATTCAATTACTTTGCTAACTTCAGTTTTTAGAGGCCCTGCAACTGTCTCAGAGTCCTTTGTTATTGAAGCTTATGGCTCGAGTTCTGTGCCGGGACAAAAAACATATCATGGAGGAGCTTTTTCAGGCCTGCTTTCAAAAAATTGCTCATCAGTAAGTACAAAACAATTCCTGTGTTTGTATCTCTGCTTACAGCTTTTTAGAATTTGTGCAAATTTACTTTTTTTTTCCCGTTGTCAGGTCTTATTTGGGAAAACAAGTTCTTCTCCTCAGCTCCACCTACCAAT[C/A]ATTTCAAGCCAAAGAAGTTCCATCAAACTTCATGCTCATGGGTCTGATAGACAGAGTCCTGCTGCCGCTGGCCTCTCACTGCAGTCCTCAAGCTCTCTCTCAGTTCTTTATCTCTAATATTGCTGATATCATGACTACTCTACAGACACGCTTCACCAAGGTGCGTGACATGAGCTTAATGAAGCTTCAAAATTGTTGTTTATTTAGAAATACTGCTATGTTTCTTGTGTTTCATCTGTCCTGCAGTCTGTTGAGTCGGTGTTTGAGAGTCAGATCATGATGAAGATTGGCTGTTGTAAGCTGTTGGAGGTGTTGTATTCTCGTCTGCCTAAAGAGGAAGTCTATTCTAAAAACTCTGCCATCAACCAGGCCTTCTGTGGCACCGGCTGCGCTGAAGGCAATGAGCTTTCCAAGAACCTCCTCAAGTATGTAAAGTGATAAGACACTTTTTTCCTCTTTAAGTGTGAATATTACACACATTATATGATTCTGTTTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45288
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1950 4119 43 86
Genomic Location (Zv9):
Chromosome 7 (position 44104217)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41094517
GRCz11 7 41374590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCACGGAGAACATGACAGGAGAGATGGTACTGCTGGAGTTGAGGAGA[C/T]AGTTTCACTGCGCTGCTTACAACTGTGCCATAGCCCTTATCAGCTGCAGC
Long Flanking Sequence:
CCACACTTAGCGCCTGGTTGACAAAAGTGTGGCAGTAAGAGTACCCAGTTAACATGTGACATGTCCCACAGTCAAAAGAGCAGTTTGGAGGAACTGAGAGACTAAGAAATGAACATGCATCTGCACACAGGGTTACATACTGTATACAGTAGAATCGTATGCTTTTTTCAATAATCAGTCTGTATGATTGCATTGGTTGCTGGGGAAAGGGGGGCATGACCTCGTATGGTGAAACAGCATCAGGTGAAACCAGGGCAGCAATGAGCTCCTCTATTTATGAAGCACAATAGAATAATTTGGGGGAACTGTCACCTTATCAATGTTTTTAAGTAATATAAAGTCTTGAAAAGTCATTCTGAAACTTGCTGTTAAAATGCCATAATGGTAAAATAATGTTAATTTGAATATTTGGCCCTAATAATGAATTATGTGTCAGATCATGTTTTGAGGCCTTCACGGAGAACATGACAGGAGAGATGGTACTGCTGGAGTTGAGGAGA[C/T]AGTTTCACTGCGCTGCTTACAACTGTGCCATAGCCCTTATCAGCTGCAGCTTCAACGAAACCAAGTTCTACCAGGGCTTCCTTTTCACTGAAAAACCTGACAAGGTCTGTTACTGCGCATGCAACAAGATTTTGTACAAGCAGGGTTTACAGTTTAGTGCTTATTTTTTCCCTGTCTTATTGCTGACTCATAACATTTAGTTTGTTCTGCATTCTTTGATATTTACAATTAATATGTGGCTTGATGTTTTGCAGAATCAGTTCATATTTGACAATCTTATTGATTCGCAAAGGGTGTACAACTTTCCTATAGAGATTGATGTAAGTATAGCTTTAAAATGATCAAATAATCAATTTGTACTTGTGCTGTTTAGTATTGTCTTTAATTTTGTTAACAGGTCCCTATTGAGAGGAAAAAGAAGTATGTCATGATTAGGAAAGAAGTGAGTGGAGAAAACGGAGGTGAGTTGTCTGAGGCTCCAACTTATTAATAACTATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12418
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 2015 4119 45 86
Genomic Location (Zv9):
Chromosome 7 (position 44103793)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41094093
GRCz11 7 41374166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTGTCTTTAATTTTGTTAACAGGTCCCTATTGAGAGGAAAAAGAARTA[T/A]GTCATGATYAGGAAAGAAGTGAGTGGAGAAAACGGAGGTGAGTTGTCYGA
Long Flanking Sequence:
ATTATGTGTCAGATCATGTTTTGAGGCCTTCACGGAGAACATGACAGGAGAGATGGTACTGCTGGAGTTGAGGAGACAGTTTCACTGCGCTGCTTACAACTGTGCCATAGCCCTTATCAGCTGCAGCTTCAACGAAACCAAGTTCTACCAGGGCTTCCTTTTCACTGAAAAACCTGACAAGGTCTGTTACTGCGCATGCAACAAGATTTTGTACAAGCAGGGTTTACAGTTTAGTGCTTATTTTTTCCCTGTCTTATTGCTGACTCATAACATTTAGTTTGTTCTGCATTCTTTGATATTTACAATTAATATGTGGCTTGATGTTTTGCAGAATCAGTTCATATTTGACAATCTTATTGATTCGCAAAGGGTGTACAACTTTCCTATAGAGATTGATGTAAGTATAGCTTTAAAATGATCAAATAATCAATTTGTACTTGTGCTGTTTAGTATTGTCTTTAATTTTGTTAACAGGTCCCTATTGAGAGGAAAAAGAAGTA[T/A]GTCATGATTAGGAAAGAAGTGAGTGGAGAAAACGGAGGTGAGTTGTCTGAGGCTCCAACTTATTAATAACTATTGCTATGTAGTAGAAATGCAAAGATTAACCGATTTTATTAATCATGATTTAATTCGTCACAGTTAATCGATCTTAAAGTATTCTCAACACTTTGTTTCTGCACGGAACAAAACTGCTGCAACTAAACAAAGTTATGTTTAAGTTTGTGCGCTAGTTTGAAGTTTCAAGCTTGTACTCTGAGGCTAATACGCACACAATGGCTGAGCCTATTAAGTAAGGGCCATGTCTTTTTTGCGCTCAAGTTTGTTATTTCTTTTACATTTACATTTAGTCATTTAGCAGACGCTTTTATCCCAAGCGACTTACAAATTAGGACAAGGAAGCAATTTACACAACTATACGAGCAACAATGAATAAGTGCTATAGGCAAGTTTCAGGTAAGTAAAGTGTAAGACGCAGAACATTAGTAGTTTTTTTTTCTTCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27016
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 2316 4119 52 86
Genomic Location (Zv9):
Chromosome 7 (position 44099346)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41089646
GRCz11 7 41369719
KASP Assay ID:
2259-9326.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCACAATTTTTATGTTCCAGATATTTTCAGTCGCTGGCCAATAATCTAT[C/A]ATTCATCAGATATAAAGAGGTGTACTCAGCAGCTGCTGAGGTCATTGGGT
Long Flanking Sequence:
AATACAATTTCACCAGATGACTCAATATCTCTATTTGGAAAGCCTTTATAAAGTTAGATTGTATGTTGATTGGGATGATTTTAGTCTTCAGGTACAGTAATTGAATAATAAAAATAATTTAATAAAATTAATCGTTATTAAAGTTACGAATGGTACATTGTCTTGTGTCTGAATCATTTTAAATTAATTATACAATCACTGGCCTTATAAACACATGCAAATGATAAATTATAAATAAACTAAACATTGAATATCCTGCGATGTGACAATTGCGAATGATTACATTGTGATATTGATGAAAGAAAATCTGAAACTATATATTTTGCTGCCCTCGCTATATTTGTATGTATTATTATTTTACATATGAGTTTCATTCATTAATTGATTATTTGATAATAAATTGTTTTCAAATAACATTTATTTTAGATATGGATTAAAATGTCATTCTCTGTCACAATTTTTATGTTCCAGATATTTTCAGTCGCTGGCCAATAATCTAT[C/A]ATTCATCAGATATAAAGAGGTGTACTCAGCAGCTGCTGAGGTCATTGGGTTAATCCTGAACTACATGACAGAAAGAGAAAATGTACGTGTGGATCTTTATTCCTGCCCGACTCTATCACATTCCACATCTCAGTTATTTATTTATTTTGCACAATGTTGTTGTGAATAAACAGAATGAAAAATTGTTCTTCATTGTAGCAAATTGAAGGGACCTTATTTAACATCACTGTTACGAAACTGATGGATTTGAGAAAGAAGGAGGTGGATGACAAGTTTATTGTTTGCTTGAGCAAAGTGTCAAAACACTTTCCACCTTTGGTGGACCGGTGAGAAGGAGGTTTATCTTTACCAGTCTTATCCGACAACAGGCTAAACATAAATGTCTGTAAAACTATTTATAATTTTTTTTTTCCACAGATTCATTAATCCTGTATTTTATTTGCTGCCAAAGCTGCATGGCATGTTGAAGACACACTGTCTTGAATGCGTGCTGAGTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7082
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 2436 4119 55 86
Genomic Location (Zv9):
Chromosome 7 (position 44098669)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41088969
GRCz11 7 41369042
KASP Assay ID:
554-5129.1 (used for ordering genotyping assays)
KASP Sequence:
GTAATAGARAAACATTGTAGATGAGAAAATAAACACTYACTTGTCTTTCA[G/T]AGATGAGGGCAGACAGCGGGTTTGTCTGGACATTATTCATAAGATCCTGG
Long Flanking Sequence:
GAAAAATTGTTCTTCATTGTAGCAAATTGAAGGGACCTTATTTAACATCACTGTTACGAAACTGATGGATTTGAGAAAGAAGGAGGTGGATGACAAGTTTATTGTTTGCTTGAGCAAAGTGTCAAAACACTTTCCACCTTTGGTGGACCGGTGAGAAGGAGGTTTATCTTTACCAGTCTTATCCGACAACAGGCTAAACATAAATGTCTGTAAAACTATTTATAATTTTTTTTTTCCACAGATTCATTAATCCTGTATTTTATTTGCTGCCAAAGCTGCATGGCATGTTGAAGACACACTGTCTTGAATGCGTGCTGAGTCGTGCTGATGTCATCCCTGAAATCTTCCTGCACCTAAAGACCAAAGGCCTCTCACAGATCATGAGCCACAAGTCAGTTCATAGCTCTGTCATAGCATTGATTTCTCTGAGCTATTTAATGTTTAATGTCTGTAATAGAGAAACATTGTAGATGAGAAAATAAACACTTACTTGTCTTTCA[G/T]AGATGAGGGCAGACAGCGGGTTTGTCTGGACATTATTCATAAGATCCTGGCATGTCTGAAGCCAGAAGAGCTGAAGGAAATTTTGGGAGCTGTCACAGCATTCGCATCTCACCCTTCTCCTGTGTGCAGAGAGAGAATGTATGATATCCTGATGTGGATTCAGGACAACTACAGGCAAGTGAAGGCTAATTCATACTTCTGCTTCTAGTGAACAGTGTAGCTGACATCATAACCTTATGCACGCATACAATGCCAAAGCATTAACACTTGTTTATTTTGTGTGTTTGGAGTGGCGTTTCTCTGTTTATTCTCTGCTGTTTTGAATTTAAGCAACTACAAAAAACAGCAACTAAAAATGACCAGATCATTATTGATCTGATGATTATCGATGTTGAAAAACAGTTACTTTTAGTGAAATTGCTTAAATTAAACTGCAAAAATTATATATGATATGAGATATGATATGATATTAGATTAGATTAGATTAAACTTTATTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17162
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 2804 4119 61 86
Genomic Location (Zv9):
Chromosome 7 (position 44092827)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41083127
GRCz11 7 41363200
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGATCTTCCTGATATTCAGATTCAGTTCAGCAGCCTCATTGCGCCACTA[C/T]AGGCCCTGGCACAGGTTWAATTCAGAGTTATTTTCAACACTGTGTGTGTW
Long Flanking Sequence:
AACTCTTTAGATGATGGGGAAAAATAGTAAAAGAGCATTTTGCTGAGTGTGCGGTATATTACTGTCCCAACTGTCTGTCTTGAATTTTTCACTGGGGAATGAATGAATAAAGCATGAATAAATTCTTGTGATAAAATGTTGCGACTTTCACAGTAGTGAACCTGATATTTGTGTTCCAAATAGCTGAGCGGGAGCGGCGTGCAGACATTCTGAGACTCAGAAGGAGATTTCTGAAGGATAAAGAGAAAGAGAGCATAAAATTCGCCAAGAAAGAAATCCATTCTCAAAGAACTGAGAGGGTAGATCTTTTTTAAATTGTAGACAAACTTTTGAGTGGTTTCCGATTATGCTTTGGATATAATACTCTTTTCTGTATTCTGCAGGAGAGAAGAGCAGATCTAAAGATCCGCCAGGATGCTCAGGTCACGCTTTACCGCAGCTACAGAGTTGGAGATCTTCCTGATATTCAGATTCAGTTCAGCAGCCTCATTGCGCCACTA[C/T]AGGCCCTGGCACAGGTTTAATTCAGAGTTATTTTCAACACTGTGTGTGTACTGCATGTTTGATGGTACTTGAGTAAATATCAGAAATGGACAACAAAGTCAGTTCTTACTTGTTTTACAGAGGGATGCCACACTAGCCAAGCAGCTGTTCAGCTCTCTGTTTGCTGGTGTGCTGGTTGAAATGGAGAGATTGAAATCAAATAAAGAAACAGCCGACATTCTGAAGGAGCTAGTGCAGACTCTAAACGCTTTCCTTAACAAGAGCACAGTCTACTTTCCGCCCTTCATTTCTTGCATCCAGGTGTGTGTGTATGTGAACGTGTGATGAGATTTAATACCAAATTGCTCTGTTTCTAAGCTAGTCTGTCAGCAAACTGTCTGCAAACCAGCTCATTAGCTATTAATCCCAGAATTTGAATATGGAAATCACCAGAAATTGCACAGGCCAAAATTTACCCATTGCTGTTTTTATCTATAAATGAATATAGCAGATTTTCAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1237
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 2939 4119 63 86
Genomic Location (Zv9):
Chromosome 7 (position 44091601)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41081901
GRCz11 7 41361974
KASP Assay ID:
554-1152.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAACGWGAGCTGCCGCCTGACACAGAGAGATGGATCCATCTTGCAAAG[T/C]AAGAGCCAAACCCATAWAGAACTGTCTTAAGTATTAACCTTATCACTGCT
Long Flanking Sequence:
TGATGGTGGGGAGATATGCGGCATCCTGGGTGTTCTCACCATAAAAATAATAATTTCATGACACTTGATATTGGTTTGTGGCATAAAACAGTAACATAATAGATTTTTAGCCATATTAAAAACAGTAGTCTTATGCATAGAAACATTTGTCCCACTGGCTGTTTTAGATTTAAAATAAAAAATAAAAAAAAACAATCCTTGGTGATCAAAGTGTTAAATGGAATTCTTGAGTTTGTAAGTTGTGTAATTAACACTGATGCAAACACTTTTTCTGCATGTCTTCCCAGGATATGAGTTACCATCATAAGGCTCTTCTCGGTGTAGAGCCGTCTCTGGTCAGTGCCACCTGTCTTGCCAGCCTGCAGCAGCCCATGGGCATCCTGTTACTGGAGGAGAGTTTACTTCATGGAGCTGGAGCATCAGAGGAACCTCCATTGAAACGAGCCCGAGGCAAACGTGAGCTGCCGCCTGACACAGAGAGATGGATCCATCTTGCAAAG[T/C]AAGAGCCAAACCCATAAAGAACTGTCTTAAGTATTAACCTTATCACTGCTTCATCAGTTCTACCCTGATTTGTATTCCTCTGTAGACTTTACAGGTCACTGGGAGATTATGATGTTGTCAGGGGAATCTTTAGTGGCAAGATTGGCACAAAGTCTATAACATTCACAGCCCTGCAAGCAGAAGCAAAGAGTGACTATGCAGAAGCTGTGAAGCTCTACAATGAGGTATTTATTCTTGGTTGCAAACTCGGAATGGAAACTGTGCTGGTTGCCTTCATTTAATACTCTAATTAAATAAAGAAACCAGGATCTTCTCTTCAGTTTAATTCTTAGTTAGAGTTTTGTTTAGGACCATCTTTTGTATAGTCTATTATGGAATAATTAGATTCATACCGTACCACAAGGTATCTTGATGGGATTCTGTGAATGAGTGTTCACATTAGAAAGAAAATTAATTGGAAAATACACTTTTATTAATAAAATAAATCCAGAGAAAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13548
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 3048 4119 65 86
Genomic Location (Zv9):
Chromosome 7 (position 44089879)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41080179
GRCz11 7 41360252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGCTCCCCTATCAGACTAGACAGAATGTGGACAGAGACATTTTATGTG[G/A]TACTWATTCTAATTTTGAGCTATTTTGCWGTGGATTTATCACCATGAGAA
Long Flanking Sequence:
TATGTAAGTAAAGTTTTGTGTATTTTTCAATTAAAGTCATTAAACCATCCAGACACTAAAAAACAGATTGAGAATGTACACAGATGTCAAATGATTTTAAATGTGTGAGAGAATAACACTCGCAATACATCGGGGTTGAGAATAAGAGTGAAAGCTGTAATCTTAAGCAGTTTATTATTTTTTTTTTTACGTATATGAGAGCATGCTTGTGTATTTCTGTGAATGCAAATTCACAAAGAGTTTAAAAAAATAGGACTTTATGCAAAGTGATTCCCAGCTGAACTTATCAATCCAACTGTGCTTTGATTCAGGCTCTAAACAAAGAGGACTGGGATGATGGAGAGCCCACAATCACAGAGAAAGATTTCTGGGAGATTGCAGCGCTGGAGGCCTACAATCACTTGACAGAGTGGAAATCTCTTGAGTACTGTGCCACGGTCAACATTGACGACAGCTCCCCTATCAGACTAGACAGAATGTGGACAGAGACATTTTATGTG[G/A]TACTAATTCTAATTTTGAGCTATTTTGCAGTGGATTTATCACCATGAGAATTAAACTGGGTGAAGTATATTTTTACAGTTATAGCACATAATTGCATCAAAATCAAAATGAATTATTACCATTAGCAAATATTTCCATCAACTTCAGTCTTAGCCTCTGCTTTTGGCTGTAATAGGAAACATACCTGCAGTACATGATGCGCAGTATGTTGAAGCAGTTGCAGATGGGTGAAACAAATCAGGATCTACTGAGCTTTGTCGATGCTGCCATGAAGACAGAGGAGCACAAGATCATCATGGAGACTCACTACAGTCAAGAGCTGAGTCTGCTGTACATCCTCCAAGAAGACTATGACAGAGCTAAATACTACGCCAACAACTGCATGCAAGTCTTCATGCAGGTCAGTTTCACTACACACCTAAACAACTTGAGATGTTTTACTTTGAGTTGTTTACAACTTTAAGTTGTCAAAATGTATTTTCAGATGATATGTTGGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16262
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3104 4119 66 86
Genomic Location (Zv9):
Chromosome 7 (position 44089538)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41079838
GRCz11 7 41359911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATCATGGAGACTCACTACAGTCAAGAGCTSAGTCTGCTGTACATCCTC[C/T]AAGAAGACTATGACAGAGCTAAATACTACGCCAACAACTGCATGCAAGTC
Long Flanking Sequence:
GAGCCCACAATCACAGAGAAAGATTTCTGGGAGATTGCAGCGCTGGAGGCCTACAATCACTTGACAGAGTGGAAATCTCTTGAGTACTGTGCCACGGTCAACATTGACGACAGCTCCCCTATCAGACTAGACAGAATGTGGACAGAGACATTTTATGTGGTACTAATTCTAATTTTGAGCTATTTTGCAGTGGATTTATCACCATGAGAATTAAACTGGGTGAAGTATATTTTTACAGTTATAGCACATAATTGCATCAAAATCAAAATGAATTATTACCATTAGCAAATATTTCCATCAACTTCAGTCTTAGCCTCTGCTTTTGGCTGTAATAGGAAACATACCTGCAGTACATGATGCGCAGTATGTTGAAGCAGTTGCAGATGGGTGAAACAAATCAGGATCTACTGAGCTTTGTCGATGCTGCCATGAAGACAGAGGAGCACAAGATCATCATGGAGACTCACTACAGTCAAGAGCTGAGTCTGCTGTACATCCTC[C/T]AAGAAGACTATGACAGAGCTAAATACTACGCCAACAACTGCATGCAAGTCTTCATGCAGGTCAGTTTCACTACACACCTAAACAACTTGAGATGTTTTACTTTGAGTTGTTTACAACTTTAAGTTGTCAAAATGTATTTTCAGATGATATGTTGGAAATTTTATAGTCTACTAGACAAGAATTTTGTACTGAGAGCACTTTGATGTATGTTTTGTTAGTTTGTTTATCTGTGTTACCCTCTTTCAATTTTTTGAAAATTAGATTTATGCCATTTCTGAAATTTGAATAAATAAGCTTTCTATTCATGTACAATACAAATGTAAAAGAAGGGAACATTTTTGGCAGAGACTATTTGAATATCTGGAATCTGGAATGTTTTCTGAAGAGCATTTCACATTAAAGGTGCTCTCAATTGAAGCATGAAGAAAGGGTGGGACATAGAGTAACCCCTCATCTTTTTGAAAACAGCCAATAGCGTTTTGTTGTTATTACAGCTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34148
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3155 4119 67 86
Genomic Location (Zv9):
Chromosome 7 (position 44088477)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41078777
GRCz11 7 41358850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCTGCAGTCTGTCCAAGCTCTGACCGAGATCCAAGACTTCTTGAATTA[T/A]ATCACAGGAGATGGTGGGTTTTTGTGCTCAGTGGAGTTGGATTAATGTTT
Long Flanking Sequence:
TGTCAGATGCCACAGAGGATTTGATTGGTTAGAATATTTGAGGAGAAACTGAAGTATGAGGTGGCTTGAATAAACTGACAAACTACAAGCTTTACATGTTTATATCAACGTTAGACCTTCTAGATGCAGATTTTGTCAATGTTTTGGTGCACACTAGCTTATAGATATTCTAAAAACTAACAATGCTGGAACTGATACCTTCTAAACTTTAGTTTAATTTTAGGGAACCCTTAAAGGTATCTTTCCATTCTTTTAAGATTATAGGCATGCAAACACACACACACACACACTACACATATTTCTAAAATAGTTTGTGCCCTTTAAAGAAGGGTTTTTTGTCTATCAACAAATAATAGGAAGTGTTTAAATACCTGCTTTTTTTCAACATGATATAATATCCTGTAGAACTACTCCAGCATCGACCCCTTGCTGAACCGCAGCCGGCTGACTGTGCTGCAGTCTGTCCAAGCTCTGACCGAGATCCAAGACTTCTTGAATTA[T/A]ATCACAGGAGATGGTGGGTTTTTGTGCTCAGTGGAGTTGGATTAATGTTTGTTTATTAATAATATTTATGAGTCTGAATTATCACTGTTTGCTCTATCGGCTTTTAGTCTCAGTGAATTCTCTCAAGTTCATGATCAGACGGTGGACCAGCCACTATCCAGATGCTAAACTGGACCCCATGAATGTGTGGGATGACATCATCACTTCTCGGTGAGTCTGCTGATTTACACAGAAAGTACAGATTTCACAGTGCTTGCCTTGAAAAATCTGAGGAGGTATAAAGCTTATTTGTGTAGACCTAAGAATGTCATCTTTGTTTTCAGTTGTTTCTTCTTGGATAAGATTCTGAAGAGACTGAAGTCCACCCCTGAAAACAGCATGGAGGTGGACGGTGCAGACCAGGGCAGTGGAGAGGAGCTCGGAGTGCTGGTCAAAACCTGCAAGTTCAACATGAAACTCCAAATGGCTGACAGCGCATGGAAACAGGTGCTCAAATGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21045
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3389 4119 72 86
Genomic Location (Zv9):
Chromosome 7 (position 44086154)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41076454
GRCz11 7 41356527
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAGATTCAGGCTCTGGAGTTGTTGAGGAGTGCTGCATGTAAAGCA[G/T]AAGAGGAAGAGCAGTCTTTCAGCCAACAGCATGTGAACACGCATGGTATT
Long Flanking Sequence:
AATTTAATCAATTTAAAATATTTTAAATAATAAAACTTTTGTTTAAAAGTTTTAAATCAATATTTCAGCAGTTATTATTTCTTCAGTTTTTTACATGATATTTACAAGATCATTCTGATTTCTTATTCGTGATCAGGATATTATTTTATTATCAGGATTTTAGTAGTTTACCTGTTTGCACTATTTAAATGAGCTAAAATACAATTTCTGCATCCTAAACATACTTTTTAAAACATTATGCATGAGATAGGGTCTGGTCTAATGGATTGAAACACAAATTATTGCTGCTCATTATTTTGTAGTGAATAAATTAGATTTGCCATTTGATTCTAGCGTTTAGTGACTTTTTGACATACTTGTGACTTCTTGTGTGCTTTTTGCACTTTAATATTAACTGTTGTTAACATTTCCACATTTGATGAGTGTCATTTATTGCTCAGGTGGTGGAGGGTCTGCAGATTCAGGCTCTGGAGTTGTTGAGGAGTGCTGCATGTAAAGCA[G/T]AAGAGGAAGAGCAGTCTTTCAGCCAACAGCATGTGAACACGCATGGTATTGTGGAAGCCTACATGACCATGGCCAACTTCTGTGACCGAAGACTACGAGAGAGTGAACAGAAAGAAGAGGGTGAGAAAACCTGAGCACCTGTACAGCACACAAGTGCTCTCTTAAATATTAGAAATTTACACAGGCTCTCTCAGAGTCTGAAAGGACACTTTTTGTGATTTTGTGTGCAGGATGAAGTGCATATAATGACACTTTAAATGTTTGATTTTAGCAATCAGTTCCAAGCTTCAGTCCTTGCCTGAACATGTCGTGAAGATGATGCTGAAGGCGCTGAAGCTTAGCTCTGAGGAGGCCAGGCTCAAGTTTCCTCGTCTGCTGCAGCTAGTAGAAGTGTACCCTGCTGAAACCCTTGACCTGATGGTCAGAGAGGTGCGTCAACATCCTTTGATGCACTACATTCATAGATTTTAGGAATCATGTTCATACTGTCATTATATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40976
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3409 4119 72 86
Genomic Location (Zv9):
Chromosome 7 (position 44086092)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41076392
GRCz11 7 41356465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCTTTCAGCCAACAGCATGTGAACACGCATGGTATTGTGGAAGCCTA[C/A]ATGACCATGGCCAACTTCTGTGACCGAAGACTACGAGAGAGTGAACAGAA
Long Flanking Sequence:
TTTCAGCAGTTATTATTTCTTCAGTTTTTTACATGATATTTACAAGATCATTCTGATTTCTTATTCGTGATCAGGATATTATTTTATTATCAGGATTTTAGTAGTTTACCTGTTTGCACTATTTAAATGAGCTAAAATACAATTTCTGCATCCTAAACATACTTTTTAAAACATTATGCATGAGATAGGGTCTGGTCTAATGGATTGAAACACAAATTATTGCTGCTCATTATTTTGTAGTGAATAAATTAGATTTGCCATTTGATTCTAGCGTTTAGTGACTTTTTGACATACTTGTGACTTCTTGTGTGCTTTTTGCACTTTAATATTAACTGTTGTTAACATTTCCACATTTGATGAGTGTCATTTATTGCTCAGGTGGTGGAGGGTCTGCAGATTCAGGCTCTGGAGTTGTTGAGGAGTGCTGCATGTAAAGCAGAAGAGGAAGAGCAGTCTTTCAGCCAACAGCATGTGAACACGCATGGTATTGTGGAAGCCTA[C/A]ATGACCATGGCCAACTTCTGTGACCGAAGACTACGAGAGAGTGAACAGAAAGAAGAGGGTGAGAAAACCTGAGCACCTGTACAGCACACAAGTGCTCTCTTAAATATTAGAAATTTACACAGGCTCTCTCAGAGTCTGAAAGGACACTTTTTGTGATTTTGTGTGCAGGATGAAGTGCATATAATGACACTTTAAATGTTTGATTTTAGCAATCAGTTCCAAGCTTCAGTCCTTGCCTGAACATGTCGTGAAGATGATGCTGAAGGCGCTGAAGCTTAGCTCTGAGGAGGCCAGGCTCAAGTTTCCTCGTCTGCTGCAGCTAGTAGAAGTGTACCCTGCTGAAACCCTTGACCTGATGGTCAGAGAGGTGCGTCAACATCCTTTGATGCACTACATTCATAGATTTTAGGAATCATGTTCATACTGTCATTATATGAAATGTGCTCTGAATTTGTGTTTGAAATTTTTTTTTTAGCTAATTTAAAAATGTATTATTTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27015
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3470 4119 73 86
Genomic Location (Zv9):
Chromosome 7 (position 44085758)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41076058
GRCz11 7 41356131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGCCAGGCTCAAGTTTCCTCGTCTGCTGCAGCTAGTAGAAGTGTA[C/A]CCTGCTGAAACCCTTGACCTGATGGTCAGAGAGGTGCGTCAACATCCTTT
Long Flanking Sequence:
GTTGTTAACATTTCCACATTTGATGAGTGTCATTTATTGCTCAGGTGGTGGAGGGTCTGCAGATTCAGGCTCTGGAGTTGTTGAGGAGTGCTGCATGTAAAGCAGAAGAGGAAGAGCAGTCTTTCAGCCAACAGCATGTGAACACGCATGGTATTGTGGAAGCCTACATGACCATGGCCAACTTCTGTGACCGAAGACTACGAGAGAGTGAACAGAAAGAAGAGGGTGAGAAAACCTGAGCACCTGTACAGCACACAAGTGCTCTCTTAAATATTAGAAATTTACACAGGCTCTCTCAGAGTCTGAAAGGACACTTTTTGTGATTTTGTGTGCAGGATGAAGTGCATATAATGACACTTTAAATGTTTGATTTTAGCAATCAGTTCCAAGCTTCAGTCCTTGCCTGAACATGTCGTGAAGATGATGCTGAAGGCGCTGAAGCTTAGCTCTGAGGAGGCCAGGCTCAAGTTTCCTCGTCTGCTGCAGCTAGTAGAAGTGTA[C/A]CCTGCTGAAACCCTTGACCTGATGGTCAGAGAGGTGCGTCAACATCCTTTGATGCACTACATTCATAGATTTTAGGAATCATGTTCATACTGTCATTATATGAAATGTGCTCTGAATTTGTGTTTGAAATTTTTTTTTTAGCTAATTTAAAAATGTATTATTTATTTTTCATTGAGTGCTCATCTTCTTTTCTTTATTCTAATTCCAATAGGTTGTGAGTGTTCCTTGCTGGCTTTTGATTGGCTGGATCAGTCAAATGATGGCTCTGCTTGACAAGCCTCAGGCGACAGCAGTTCAGCATGTTATAGAGGAGATTGCAGAATGCTATCCACAGGCACTCATATACCCGTACATGATCAGCAGTGAGAACTACACTTTTGAGGAGTCTGCAAGTGGTCAGAGGAACCGAGAGTTTGTTGAGAAGTGTGTACTTATCTCTGTAGTTCTGGATGTGGCTTTGGCTTTTCTCGTATTGAGACATGCAAACTATTGTTTATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34147
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3845 4119 81 86
Genomic Location (Zv9):
Chromosome 7 (position 44081766)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41072066
GRCz11 7 41352139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTATGATGAGTGGATCAGTAAAGTTGCTGGAAAGGTGGAGGGCATTAGA[C/T]GATACGCTGAATTGTACAAGTAAGTCATTGTTTCATTTATTAAAAAAAAA
Long Flanking Sequence:
GTAAACTCCACACAGAAATGCCAACTGACCCAGCCAGGGCTCAAACCAGTGACCTGCCTGCTGTGAGGCGATTGTGCTACCCACTGCGCCACTGCAACACCCAGCTTTCCAATATACTTGAAAATAACTTCCCTTGTGTTTGGACCAAATTACGTGGTTTAACGATTACAGAATTTTCCTTTTTGGGTGAACTATCCCTTTAACTCCTCTTAATAGTATATTAATGAATGTCTGCTGACATTTCCAGGATCGGTCTGATTGAGTGGATGGAGAACACTTGCACCCTGAAAGACTTCCTTTCCAGCAGAAGGACAGAACAAGAGCAGAAGACAATCACAAGGTGAACATTTATTCCTTTTCCTGTGTCTGCATTCATACCTTGCATATCTGCTGATTCTAATTGATGAATAACACATTGCTTTGGTTTAATGCATTTTAGGCCCAATGAATTCTATGATGAGTGGATCAGTAAAGTTGCTGGAAAGGTGGAGGGCATTAGA[C/T]GATACGCTGAATTGTACAAGTAAGTCATTGTTTCATTTATTAAAAAAAAATATTTTCCCATTTGTCATGGGTAATTTTAAAGAATGACTTGTTCTTGTATGAATAGCATTCATAGTGAATTTGGGTCATGTTCTTTTTATTTAAAGCGGTGGTATTTCATAAATTTAGAGTTATTTACACTGTTAAATTGTTGGACTGTCATGCTCAAGTATGGGACAAGTTGTGACTAATTTTGCAAATTGTTATTTTTTGAGCCTGATTCTTTGTTGTGTAACCAAAGATGAAAATCCTTTTATGGGCGCATCTCCAGGAAAAGCACATGTGTGACCAGTGAGAGTGTGTCTATCACCCTCTGACAGTGCTACACCGGACTTGCCTGAGAATGACAAGTCAAAAAAGTATGCTTTTGGATGTGAGGGGAAGCTGATCTTGTGTAGCCAAAGTTAAAGGTGCAGTAGGCGATCTGCCTAAATGCTAACCAGTTAGCGTAATAGCTTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8282
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 3875 4119 82 86
Genomic Location (Zv9):
Chromosome 7 (position 44080043)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41070343
GRCz11 7 41350416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGAATAACTTTAGAAGAATTGAGCAGATGGTGCCGGACGACYTGTTAAA[G/A]TAGGCCAACATTTCACTCTCTGTTTCACATTGCARGATTTAATTTTTATA
Long Flanking Sequence:
TATTATTTTGTCTTCTTTCACAAACATCAGCATACATATTATATGTGAATTAAAATGTCTTCAACCTAAGCACACATCATTTAATAAAAAGGCAGCTTTAATTTAGCAGCTGATCAATGATGTACTGAATGTTCTAACCACACTGGTGGGATCGTACACTCCAGGGAGCTTATCAATCTGCTTTGTGTTGACTGTCAGTATCTTTGTCTTAAAAGTATTAAAAAACAAAAGACTTGTTAGAGAAAATATGGATGCAGTGCTACTATACAGGTATTTAAGATTAAAATGAGATTGGGCAAAGTGAGCAAGATACATTCCCTTTAACTAAAAAGGAGCTATTACAACATAGTATACTCAATCTTTAAGATAATTGAAGTTGAAAGATTTTGGAAATACTTATTCACACATTTCAATTTGATGTACTACAGAAAAGCAAAACGTGTGGACACTGTGAATAACTTTAGAAGAATTGAGCAGATGGTGCCGGACGACTTGTTAAA[G/A]TAGGCCAACATTTCACTCTCTGTTTCACATTGCAGGATTTAATTTTTATATTAAAATGTTATTATGATTCATTGTTTAAATGCAATATTCTAATGTGAAACAGAATTAATGCTGCCACGAACACTTGCTTTCAGACGTGCTTTTGTGAGGATGAGCACCACACCCGAAGCCTTCCTTTCACTGAGGTCCCATTTCAGCAGTTCTCATGCTGTGCTCTGCATCAGTCACTGGATTCTGGGCATTGGTGATAGGCATCTCTCCAACTTCATGATCAATACAGAGACTGGCGGCATGATCGGCATTGACTTTGGTCATGCTTTTGGATCAGCCACTCAGGTGGGTCTTTGTCCAGTATGGAGAAAGAGTTGCTATACAAACTTGAAAAGAAGTTGAGTAAAGCATCGGGTCAAGCTGTATCATAGATGATGACAATAAGCTGTGTTGCATGTAGTTTCTTCCAGTGCCTGAACTGATGCCGTTTAGACTGACCCGGCAGTTTA
Associated Phenotype:
Not determined