Busch Lab

ZMP

ptpn22

Ensembl ID:
ENSDARG00000075062
ZFIN ID:
ZDB-GENE-060503-458
Description:
tyrosine-protein phosphatase non-receptor type 22 [Source:RefSeq peptide;Acc:NP_001092890]
Human Orthologue:
PTPN22
Human Description:
protein tyrosine phosphatase, non-receptor type 22 (lymphoid) [Source:HGNC Symbol;Acc:9652]
Mouse Orthologue:
Ptpn22
Mouse Description:
protein tyrosine phosphatase, non-receptor type 22 (lymphoid) Gene [Source:MGI Symbol;Acc:MGI:107170

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa12441 Essential Splice Site Available for shipment Available now
sa37721 Nonsense Mutation detected in F1 DNA Not yet available
sa9634 Essential Splice Site Available for shipment Available now
sa11960 Essential Splice Site Available for shipment Available now
sa24347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12441
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 97 905 None 30
ENSDART00000103869 Essential Splice Site 97 130 None 4
ENSDART00000129280 Essential Splice Site 97 888 None 29
Genomic Location (Zv9):
Chromosome 23 (position 26441918)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26228038
GRCz11 23 26154579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATTCGAGAGGATTTGGGAACCACTTGTCMTGTATTCTGTATTTATTTC[A/T]GGGTGTTTCAGGCTCTAAAGCATATATTGCCACCCAAGGGCCACTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37721
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Nonsense 102 905 4 30
ENSDART00000103869 Nonsense 102 130 4 4
ENSDART00000129280 Nonsense 102 888 4 29
Genomic Location (Zv9):
Chromosome 23 (position 26441935)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26228055
GRCz11 23 26154596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAACCACTTGTCATGTATTCTGTATTTATTTCAGGGTGTTTCAGGCTCT[A/T]AAGCATATATTGCCACCCAAGGGCCACTGTCAAACACTGTGCTTGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9634
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 308 905 11 30
ENSDART00000103869 None None 130 None 4
ENSDART00000129280 Essential Splice Site 308 888 11 29
Genomic Location (Zv9):
Chromosome 23 (position 26449018)
KASP Assay ID:
2261-7832.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTGCTGTTYGAAAGATATCTGGCAGCACTTGAAGCACCAAGTAACAAG[G/A]TYRGATGAGAACAAACTAAATACAACAAWGATGCCAAATATTACATTTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8017
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 613 905 16 30
ENSDART00000103869 None None 130 None 4
ENSDART00000129280 Essential Splice Site 599 888 17 29
Genomic Location (Zv9):
Chromosome 23 (position 26453553)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26238751
GRCz11 23 26165292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTTTGCCAGAAAGAACTCCGGMGTCTTTTGAAATGGCSATGGATGCGGG[T/A]ATGACTNGAGCATGGATAAACCATCATATTTATTCTGGTTACTTCTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11960
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 844 905 27 30
ENSDART00000103869 None None 130 None 4
ENSDART00000129280 Essential Splice Site 827 888 26 29
Genomic Location (Zv9):
Chromosome 23 (position 26459206)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26244936
GRCz11 23 26171477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAACAAAGGGRCAGAGAAAACTTCACTGGTCAGCAAAGCAAGGAGCAAG[G/A]TTCAACTTCTTAAGTCTCTWAATTTTGGAACATRTTGTAAAGKGTTTRAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24347
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Nonsense 854 905 28 30
ENSDART00000103869 None None 130 None 4
ENSDART00000129280 Nonsense 837 888 27 29
Genomic Location (Zv9):
Chromosome 23 (position 26460595)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26246335
GRCz11 23 26172876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTGTTTCTTTTCTATTGCAGAGTTTCAAGCTTTTAAAAGGAAAACAG[A/T]AGCGTATGTATAATAAACTTTTCTACATTTCATGCTGCTTAAATCTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29938
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087343 Essential Splice Site 854 905 28 30
ENSDART00000103869 None None 130 None 4
ENSDART00000129280 Essential Splice Site 837 888 27 29
Genomic Location (Zv9):
Chromosome 23 (position 26460599)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26246339
GRCz11 23 26172880
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTCTTTTCTATTGCAGAGTTTCAAGCTTTTAAAAGGAAAACAGAAGC[G/T]TATGTATAATAAACTTTTCTACATTTCATGCTGCTTAAATCTGTTTAATA
Associated Phenotype:
Not determined