Busch Lab

ZMP

RASGRF2 (1 of 2)

Ensembl ID:
ENSDARG00000075054
Description:
Ras protein-specific guanine nucleotide-releasing factor 2 [Source:HGNC Symbol;Acc:9876]
Human Orthologue:
RASGRF2
Human Description:
Ras protein-specific guanine nucleotide-releasing factor 2 [Source:HGNC Symbol;Acc:9876]
Mouse Orthologue:
Rasgrf2
Mouse Description:
RAS protein-specific guanine nucleotide-releasing factor 2 Gene [Source:MGI Symbol;Acc:MGI:109137]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa30930 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41571 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41572 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30930
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081794 Essential Splice Site 178 1028 3 21
ENSDART00000081794 Essential Splice Site 178 1028 3 21
Genomic Location (Zv9):
Chromosome 10 (position 3095983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3122764
GRCz11 10 3068628
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTCAACTGGAGGACCAGGATACAGAGATCGAGAGGCTGAAGGCCGAGG[T/G]TCGTTTATCGTCTTCAGCTCAATCCAAGGTTGTCAGGTGCCAGAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41571
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081794 Essential Splice Site 178 1028 3 21
ENSDART00000081794 Essential Splice Site 178 1028 3 21
Genomic Location (Zv9):
Chromosome 10 (position 3095983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3122764
GRCz11 10 3068628
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTCAACTGGAGGACCAGGATACAGAGATCGAGAGGCTGAAGGCCGAGG[T/G]TCGTTTATCGTCTTCAGCTCAATCCAAGGTTGTCAGGTGCCAGAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4354
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081794 Nonsense 387 1028 8 21
Genomic Location (Zv9):
Chromosome 10 (position 3103200)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3115547
GRCz11 10 3075845
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTTGTTGGGATTKAAATATTTGCTTATTTCCATTGTTAWTAGATCCCA[C/T]GATACATCATCACGCTCCATGAGCTGCTCGCTCACACGCCTCATGAACAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41572
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081794 Nonsense 751 1028 15 21
Genomic Location (Zv9):
Chromosome 10 (position 3115572)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3103175
GRCz11 10 3088217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCCCCCATCCACTCCCGCAAGCTGTCCCTCAGCTCTCCTGTCAGCTG[T/A]AAGGCTGGAGCTCTGGATCTCTCCACCTCCACCTTCTCTGCAGCCAGCAG
Associated Phenotype:
Not determined