Busch Lab

ZMP

ENSDARG00000075038

Ensembl ID:
ENSDARG00000075038
Human Orthologues:
MUC12, MUC4
Human Descriptions:
mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
Mouse Orthologue:
Muc4
Mouse Description:
mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39352 Nonsense Mutation detected in F1 DNA Not yet available
sa45749 Nonsense Mutation detected in F1 DNA Not yet available
sa32364 Nonsense Available for shipment Available now
sa24039 Essential Splice Site Available for shipment Available now
sa43728 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39352
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Nonsense 1493 2228 5 8
Genomic Location (Zv9):
Chromosome 21 (position 43713143)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45452721
GRCz11 21 45495058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGTCAAGAACAACTGCACCTAATGGCCCTTTCACCATCATAGATCTTT[T/A]GGGTTCAAAGACATCTGTTCCTGTTGATTCTACAACTGCTGCAATTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45749
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Nonsense 1511 2228 5 8
Genomic Location (Zv9):
Chromosome 21 (position 43713088)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45452776
GRCz11 21 45495113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAGACATCTGTTCCTGTTGATTCTACAACTGCTGCAATTCCTGCATA[T/A]CAGTCAAGCACAACTGTTCCTCTAGACCAATCAAGCAATGTAGTTCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32364
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Nonsense 2081 2228 5 8
Genomic Location (Zv9):
Chromosome 21 (position 43711380)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45454484
GRCz11 21 45496821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAAGCATCTACTGGTTCAGCAATGCCAGGGGAGGTATTTGTTGTTCTG[C/T]AGATTCGTTTACAAACACAATATATTGATGCTTACAATAACCCTGCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24039
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
Genomic Location (Zv9):
Chromosome 21 (position 43711289)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45454575
GRCz11 21 45496912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCTTCCGTGGAGTACCAGAGTCTGTCCAGAAACATCACTATTGAGG[T/C]AATCCAACCAACAATTATTTTCTTACTTATGAAGACTANNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43728
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
ENSDART00000114796 Essential Splice Site 2110 2228 5 8
Genomic Location (Zv9):
Chromosome 21 (position 43711289)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45454575
GRCz11 21 45496912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCTTCCGTGGAGTACCAGAGTCTGTCCAGAAACATCACTATTGAGG[T/C]AATCCAACCAACAATTATTTTCTTACTTATGAAGACTANNNNNNNNNNNN
Associated Phenotype:
Not determined