Busch Lab

ZMP

FAM120A

Ensembl ID:
ENSDARG00000075021
Description:
family with sequence similarity 120A [Source:HGNC Symbol;Acc:13247]
Human Orthologue:
FAM120A
Human Description:
family with sequence similarity 120A [Source:HGNC Symbol;Acc:13247]
Mouse Orthologue:
Fam120a
Mouse Description:
family with sequence similarity 120, member A Gene [Source:MGI Symbol;Acc:MGI:2446163]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa2594 Nonsense Available for shipment Available now
sa35100 Nonsense Mutation detected in F1 DNA Not yet available
sa35099 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2594
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021949 Nonsense 112 1104 1 18
Genomic Location (Zv9):
Chromosome 11 (position 28614996)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27490982
GRCz11 11 27738156
KASP Assay ID:
554-2715.1 (used for ordering genotyping assays)
KASP Sequence:
GCTTCAATGGCGCCCTGGAGAAAGGCCGTCTCCACGAGTGGGTCAAGCGA[C/T]AGGTGAACGAGAGGCAGACCGCCCAGCAGATTGTCAGYCACGTCCAGAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021949 Nonsense 185 1104 2 18
Genomic Location (Zv9):
Chromosome 11 (position 28607932)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27483918
GRCz11 11 27731092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGTGATTGCCTTATTTCGAGAGAACGGCTTCCATGGTCTGGTTGCCTA[T/A]GATTCGGATTACGCCCTGTGCAACATCCCATATTACTTCAGTGCCCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021949 Essential Splice Site 818 1104 14 18
Genomic Location (Zv9):
Chromosome 11 (position 28587320)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27463306
GRCz11 11 27710480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACTTTTTAATTAGCATTTTAAATTAAGGATGACCTGTTGTTGTTTCC[A/T]GACTGAACTAGTTGCCAAGGTGGAGAAGATGCGTCAGAGTATTCTGGAGG
Associated Phenotype:
Not determined