Busch Lab

ZMP

grinl1a

Ensembl ID:
ENSDARG00000075017
ZFIN ID:
ZDB-GENE-041111-91
Human Orthologues:
AC090651.1, GCOM1
Human Descriptions:
GRINL1A complex locus [Source:HGNC Symbol;Acc:26424]
GRINL1A complex locus protein 1 [Source:UniProtKB/Swiss-Prot;Acc:P0CAP1]
Mouse Orthologues:
Gcom1, RP23-357O18.3
Mouse Description:
GRINL1A complex locus Gene [Source:MGI Symbol;Acc:MGI:2142908]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17153 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27059
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110265 Essential Splice Site 164 584 5 14
Genomic Location (Zv9):
Chromosome 7 (position 53858167)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52128017
GRCz11 7 52403087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTGGAGGGATGCAACAATCAATGCAAAAATTAACTCAAGACTTAAAG[G/A]TAAGCAAAACACAGCATGACAAGTGGCTATGGAAAGAATATTGAACAAAT
Long Flanking Sequence:
CACACTTAGATACACAGCAGTGGCATTGGTCTTCATGCACCTAAACACAACAGTGACACTGTCTCCGTTTAAACACATCCACTAGCTGAAATGTGAGCCTTGTTGTCCTGTTCCCCCAGCACCTTGTGACCAATGGCATTGGCAGGGAACAGTCCGCTCAGAATGGGCCCAGAGTCTATGGTGTGGTGCAGAGCTCAGGCACCAACCAACAACAGGAAGTGATGGCACGAGAGTGGTCTGTCAATCAGCTGAGGGACGAGATGAGGTACATCCGAGAGGTAAGCTTAATAAATTGTCTATTGGTACCTAAATTTAACTGTAAGACAACTGGATAGTGGATTCTCTACCGGAATGCACATTTTGGAAATGTATATATCTTTCTTAGAAGCTTCCTCCTTTTCTCAAAGGTACGTGACTCTTTGGAGAAAGTCAGAGAGAGGATGTATGGCCAGTTTGGAGGGATGCAACAATCAATGCAAAAATTAACTCAAGACTTAAAG[G/A]TAAGCAAAACACAGCATGACAAGTGGCTATGGAAAGAATATTGAACAAATATTAGTAAATAATCGCTGTATTCATACTGTTGGAGTTTATTCTGCATGAAAGACCGGCTGAGTGTACATTATCCTCATTAATACATACATATGTTGTTACAATGATGTAGTAGTAATTATATTAAAAGTATAGCAGTAGTAGTAGAAAAATAAGTGAAAAAAAATTTACAAAACAATTGACCAATACTTTCAGTAATGGTCCGAAAGGCTTTTACTACTACTTTGCCAGCAAGACGTGTCATCCTTTTAAAGTGGAAAAATGTTTCTCCACCTTCTTTTGATGCATGGATAAAAGAAGTGTTTACTTATATTAAATTGGAAAAAAATTTACTATGATTTATTGGTTCTTTAAAGACATTTGACAAGTTGTCGCTTCCCTTTTTAGATTATCTGGTAGCTAACTCTCTTGATTTTTAAACTGAGCAATAATACATATATGAATACATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17153
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110265 Nonsense 365 584 10 14
Genomic Location (Zv9):
Chromosome 7 (position 53849762)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52119612
GRCz11 7 52394682
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATTGTGAGCAACGCTTGCRTGGTTTGGATGAAACWGACCATGCAGAC[A/T]AAGCTGCGGCCAAACAGTAAGTAACATCTAATTTATGTTCTGAAAATATT
Long Flanking Sequence:
ACTTTTACAAACTTTTTAACATCAAGAGCTTTTGGAGAAAAGATCAAAGTTGCATAATGCTATTCAAAAACATAAAGTGAAAAAAAAAACATGAAAAATACAGAAAACAGTCAATTTACAGATATTTTTTACAGTGTGGGAACTGACTGGTGAATAGGAGCAGACAAGAATGATTGTAGTTTTGAGTGTAAACCTGTTTGTCCTGTCTACAGGCACAGCTTGACGACTATATGAAAAGGCTTGAGGAGGCCGAGAAAAATGCTCAGATTGCTGAGGCAAAGATTGCTGAAAGAGACCAAAGAATTGCAGAAGTGGAGAGGCTGCTGAACTGTATGGCTCAGGTAAATATGATCAGATAGTTCAGCCTTATACTTTTTACACCTGAAGGAAACATTTTATGCATCATTTCATTTTTATAACAGGAGAAGGGAGACCTGATAAAAAAGCTTTGTGATTGTGAGCAACGCTTGCGTGGTTTGGATGAAACAGACCATGCAGAC[A/T]AAGCTGCGGCCAAACAGTAAGTAACATCTAATTTATGTTCTGAAAATATTTTCCACCTAAAAATATTGATTATGTCTTATTCAGGATAGTTTTAGTAGACAGTCTATATATCTTTATATAAGATTTTTTGTTTAACAATGTATCACAAAATCTTTTTTTATTTAATAAAGAAGCTATGTTTTTCACACAAAAAAAATTCAGTAGCTATGGTACATGTGGTAAAGGTGAATTGGGTATGTTAAATTGGCCATAGTCTATGTGTGTGAATAAGTGTGTATGGGTGTTTCCCAGTGATGGGTTGCAGCTGAAAGGGCATCCACTGTGTAAAACATATGCTGGATAAGTTGGCGGTTCATTCTGCTATGGCAACCCCAGATTTATAAAGGGACTAAGCCAAAAAGAAGACGAATGAATATTTACATTTAGGAATTTACAAATTATTTTCATAGAACATGACCTTTACTTAATATCCTAAATATTTATGGCATAAACGTTTATAA
Associated Phenotype:
Not determined