Busch Lab

ZMP

usp45

Ensembl ID:
ENSDARG00000075013
ZFIN ID:
ZDB-GENE-100211-2
Human Orthologue:
USP45
Human Description:
ubiquitin specific peptidase 45 [Source:HGNC Symbol;Acc:20080]
Mouse Orthologue:
Usp45
Mouse Description:
ubiquitin specific petidase 45 Gene [Source:MGI Symbol;Acc:MGI:101850]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa13100 Nonsense Available for shipment Available now
sa12916 Essential Splice Site Available for shipment Available now
sa42767 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36194 Nonsense Mutation detected in F1 DNA Not yet available
sa36193 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28695 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13100
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Nonsense 148 830 5 23
ENSDART00000137232 None None 803 None 18
Genomic Location (Zv9):
Chromosome 16 (position 35036219)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32767719
GRCz11 16 32721749
KASP Assay ID:
2260-9951.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAAAAGCAGTCAGCAAAAGCCACCTCAGGTAATTAATCCACAGAAAAA[C/T]AAGGAGAACAATGTTAAANNNNNNNNAATTTTAGGAACATGAYAYATTTT
Long Flanking Sequence:
TAAGCAATGACACACACTTTTCAAAAATGTACATGCAACATATACTCCTTTGTATTGGACATAAAAGCCATAATAGAGGGCAGCAGTTGAGTTCTAGACTTAAATAATCCATTCTCCACAGGGAAATTGATTTTTAACATTACCTGACAAGTCCTTACAGATAGACCTGTTGTGAGGTCCGAAGATGTTAATCGATTTAATATGCTTTCGCTGACCTATTGATCTCTTTGCAATAATCCACTTTATTTTGAATTCATGCAGAAAAATGACTTTAAGCATTATTCTGTAAAGAAAATACCTCTAGGTTAGAGAGTCAGAGACAAATTGCACTACGAATTGTGTTTTACCGTTAGATGATGCTTTTGTTCTTGTTTAACAGGTGCTTTGAATGTAAGGAAGAGCTGTCCACTCACTGCAATAAGAAAGCATTGGCTCAGACTCTGGACTTTCTGCAAAAGCAGTCAGCAAAAGCCACCTCAGGTAATTAATCCACAGAAAAA[C/T]AAGGAGAACAATGTTAAACTTTGTTCAATTTTAGGAACATGACACATTTTTCTGCTGTTAGTAGTGAAGGTTGTTGAACTTTTGTGAATGTACGTTATTATAGCGGCTTGCTTTTTTATTTAATGGATTAAAAACAGAACATTTTCTCTTTTTCCTGTGCTATGGTGCGTTCAAAGATGAGCTGTTTCTTTCAGATGGCTCTTTTAAAAAGCTCTTCATTGTTTCTCTGTGCAAACAGCAATGCCATGTTAGCACATCTGTCGTCACTGACCTTTGTCCTCAGATCACTAGGTTTTAGCTTTCCAGATACAATTAGGAGAGGACTTATGTCATTGCAGTCTTTAGTTAACCTAAATGCATTGTGATATTGCAAAGACTTCAATTTATTTCTTGTATTTACATGAATTGATTTTAAAAAAAGAACAATAAAAAAAATGTTCCTTCATACTTGAAATGGTTGACCTTGAGTAAATGACATCCAGGGTTATTTTGACTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12916
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 319 830 12 23
ENSDART00000137232 Essential Splice Site 313 803 9 18
Genomic Location (Zv9):
Chromosome 16 (position 35012136)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32743636
GRCz11 16 32697666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAATTGCTGCATTACCYCCTGGACTCTATGAGAGTGGAGGAGACAAAGG[T/G]GAGTGTGTGAGATCGTGTNNTTTTTTNCCTTCTCTTCTATTAATAAAGATTWA
Long Flanking Sequence:
TAAATTCCAATCTTGGATTTGTAATTCAGCTGAATGAGAGAATTGGTTAAAGGTCTGAATGTGTTTATGCGTCTGTTTGTGTGTGTGACCAACTGACCTCGGCTGGTTGAATGATGAAATGAAAGTGAATGAAAGTTGTCAGGGAAATAATAATAGCAGCCTCAGAGTTCCAGAAACCTGCAGCGAGCAGCGCGAGTCTCCTCGTGCAGTGTCAGAGGAAAGGCCTTGAGAGAAGATTATGGTCATTCTTCTCTCGTCTTTACTCCTCTATATGCTGCCGATTGGTTTTTGTGTGTGGCTAATTGGTGTTTGCGTGGCTTCGGCTGCTTTTGTCCCCGTAGATGTATTTACACTTGTGCCAATGCATTTGTAAGATGGAGAAGCTCATTGTGTGTGTGTGTGTGTTTGCAGGGCTCCTCGTTTTAAGGGTTACCAGCAGCAGGACAGTCAGGAATTGCTGCATTACCTCCTGGACTCTATGAGAGTGGAGGAGACAAAGG[T/G]GAGTGTGTGAGATCGTGTTTTTTTCCTTCTCTTCTATTAATAAAGATTAACTTAAGACCCGTTTGCTTGTAACTAAGGTTGGAGTAAGATATATACCAAAGTAGTGTATCTGCATAAAATTCAGAATTACATATTTAACATTTTATTAATTAATAACAAATGCAAATTAGTTCAAGTTAACTTTTTTATGAAGGTGCAGTAGATCAAAATGCTCTTTGTTCAATAATAACAGTTTATTGTAAATAAATAATAAGTTTATTTATTTGAACAAATGTACTTTTTATTATAATAATAATAATATTATTATTATTAATAATAATAATAATAATATTAATAATAATTCTCCATCGATATCAAAGCAGACGACTCGCTTCATTCTAGATGTCTTTCAGGATTGTAATTGTAGGCCTAACTACTCTGTATAACATACCGATATTGTGTAGTCCTACAATGTGACGAAGCCACAGACATATGCAAGAGGCAGTGCACACTTTTTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42767
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 346 830 13 23
ENSDART00000137232 Essential Splice Site 340 803 10 18
Genomic Location (Zv9):
Chromosome 16 (position 35001391)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32732891
GRCz11 16 32686921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACCCCACAGAGAAGACTGCAGACGAGGAGACCAAACGACAAGTGAAGG[G/A]TGATTCAGCTCTGCTTCCGTCACATCACTCAAAACAATAGTGCCATCTAG
Long Flanking Sequence:
AAATATTGTGGATTCTGTAATTCAGAAAATACTGCAAACTGATGTAATAAAATGTAGATAATCAATGTATGCATGAACATCTCTGTCTGTAAAAGCTTTCAGAATATTGATATGAATAAAGTGCTGCTGAAGTCAAGATATATGGTGCAGTCCAATAAAAGAAATCCCTTAAAAAATGTATAATTGAAATGTTCTTTTACAAATAGATAAAGTGTCATTAAAATAAACTTATAATGTGTTTTTATGATAATTCTAATAGATAGAAAAACTTGAAAACAGTTTTGGTCTGCAGTGTTTCACTTTAAAGACGGAAGTCTTTTACTGTGCTCCTTTTATTTTGAATGTGATGATAAATGGAGCTTTTTGTGACCACTTTATTATCTAACCAAGTGGCATGCCATTGTGTTTTCACTGACAGCGCATTAAAGCGGGGATCCTTAAAGCCTTTAACAACCCCACAGAGAAGACTGCAGACGAGGAGACCAAACGACAAGTGAAGG[G/A]TGATTCAGCTCTGCTTCCGTCACATCACTCAAAACAATAGTGCCATCTAGTGACCGCTTGCTTTCTTTACCTTCTAGAAATAGTTATGCGTTAAATCAGAATTTGAAAAATGATCTGTTAATTGCGTTCTGCTTACTAGTATCTGTTTTATGGTGTTTATATTAATTAGATATTTTTATGCTTTACAGCTTATGGAAAAGAAGGAGTGAAATTAAATTTTGTTGATCGAATCTTTGTCGGAGAGCTGACCAGCACCATAATGTGTGAAGAGTGTGAGCATGTACGTTTTTTAAATTCCTGATCATTTGTGTTATCTATGATCAGTCTTTTTAGCTCAAAAGTTTCATTGCATAGCTAAAAAAGAAAGTCTACATTACACTTCTTTTTGGCTTTGATGCTTCAAAACCATGGGTCTGAAACTGGATTCCTGGAGGGCCGCAGCTCTGCACAGTTTTGCTTCAATCCTAATCAAACACATCTAAACCAACTAATCAAGGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28696
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 440 830 17 23
ENSDART00000137232 None None 803 None 18
Genomic Location (Zv9):
Chromosome 16 (position 35000028)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32731528
GRCz11 16 32685558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTACAGTTAAAAGTAAAATACGGAAAAATATTGTTGCGAATTTACTTTT[G/T]AATATACACTACAGGTCAAAAGTTTGGGGTCAGTTTTAATTTTTTTTTCA
Long Flanking Sequence:
TCTACAGTGAAGGAAGCCTTTATTGACATTTCTCTTCCCATCATTGAGGAAAGGGTGAGACCAGCCTTAATTTATTGTTCAACAATTGTATGTTTCTTATTTTCTCTCCTGTATGATAAAAATATGTCCTTGCTGTGAATGAACTGTGTTGAGTTGAGTGAAATCTTTTGTTGAGGTTTTGCTGGTTTTCTTTTACAGATTTCAAAGCCCACAAACCCTGCTAGACTGGGCAAAAGTGGGCGGGAACAAGACAGTCTGACCTCCCATGATGACTCATTAGCTGCCCACTCCCAGGCCAATCGAAACAGCAGGAGGCTCAGTGGACAGGTAAGCGGAGCCATGAGTATTAATAAAACACAAAATATACAGTATTGATTGTGTTCAGTTAAAATTTTTTGTGTTCCTGAAAGAAGTCTCTTCTCCTTTCCTATCTGCATTTATTTAATTATAAGTACAGTTAAAAGTAAAATACGGAAAAATATTGTTGCGAATTTACTTTT[G/T]AATATACACTACAGGTCAAAAGTTTGGGGTCAGTTTTAATTTTTTTTTCAAGAAAATTATTATGTTGATCAATTAAATATTTATTAAAAATTTAAATAACTGCTCTCCTATTTTATATAGTTTCAAATGAAATCATTACTCCAGTCATTGTTGCTTTTATTACTTATACCATTAATAATAATAATAATAATGATAATAATAATAATAGTAATAATAATAATAATTTGTATTTTATTTTATTTATTTATTTATTTATTTGTTTATTCATTCATTTATTTATTTATTTTTTTTTTTTTTGGCTGTGGTTTATTCTAAACTAATAATGTCCAGTAGATAGAGCTTCCGGGATAGATCAGTCAGAGCAGATGGATCCAGATTTTTAGGATTGTTTTTTGCAGCAGTCAGAACAACTGACAAAATCCTTCTTTGGTTGATGGATAAGGAGAGTGATGAATCGTCCAGCATGAGAAAAAGCATTGGGTCGCGTTGGATCTGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36194
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Nonsense 532 830 19 23
ENSDART00000137232 Nonsense 504 803 14 18
Genomic Location (Zv9):
Chromosome 16 (position 34997625)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32729125
GRCz11 16 32683155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGACAGCAGTAACGATGCAGACAGCGAGGCCTCTGAAAGTGAATG[G/A]TCTCCCCGAATCCCATCAGTGTCCAGTCACAGCAGCACATCAGATAAAAC
Long Flanking Sequence:
ATCACGCTGCTTTGTTTACTTCAGTAACCAAGGCAACACCATTATTTCTGCAGTTCAATAGGCACCAACCTGCTGAATTAGCTAGATTTAATAGATTTTCATTCAGTATATGAATTATGTTTTAGTTTTGGATTAGTTTCTTACATTAATATTTAGTAAATATATTGTACAATTAAAATCTCGGCAGTGTTTCCGGTTGAAACCTAAAGTGGTTATGAGTTCTTAAAGTATATTAAAAGGTTGTTGAATTTTTTTTTTTTTTTATTGACTATACGACTCTGTTTTCAGAAGCTACAGAGCCGCCATTCGTCCACGTCTCATGATGACCGAGGCCCAGACACTGTTTCTAGCCGTCAAGAGGAGGATCTCTGTGTGGCTGGCCGTGGCCTATCCAGTTACAGGACTGATACAATGGGCAGCCAGTCAGACTGCAGTGAAAAAGAGTCAAACCTGCAGGACAGCAGTAACGATGCAGACAGCGAGGCCTCTGAAAGTGAATG[G/A]TCTCCCCGAATCCCATCAGTGTCCAGTCACAGCAGCACATCAGATAAAACCTCAATCACCACAACTCTATCCACAACAACACACAATCCAAGTTTAAAATCGAACCCAAGCTCCACTCCATTACCCTCCATTAGGCCCCAGCAGGGCGGCGCTGTGGAGCAGCTTGTCAGCGCTGTGTCCAAACTGGGCCTGGTTCACACATCCACTGATACTCTACCCATCAGCCACAGCCAAGAGGAGCTGAGTGAGACCCGGGACAGAGACCGTCAACACCATCAAGGGGCCTTTCAAGTCCTCTGTCACAGCTACACCCCCAGCTCAAAAGAGTGCTCTGTCCAGTCCTGCCTTCATCAGTTTACCTCTATTGAGCTGCTTATGGGAAACAACAAGCTGCTCTGTGAAAACTGCACTGACAGGAGGCAGAGGCAGATGAAGAGGAGCGGTATGTATTACCGACACATTTTCAAAACTTTACTATATATGTGGCTTAGGGCTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36193
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 742 830 None 23
ENSDART00000137232 Essential Splice Site 714 803 None 18
Genomic Location (Zv9):
Chromosome 16 (position 34994102)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32725602
GRCz11 16 32679632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAGTTTACAGTGTTCTTCCCAATATAGATTTGTTGTTTATGTTTGGC[A/T]GAACCTCGGGTCAGGAGAGCGTGTGCTTTACAGTTTGTATGGCATTGTGG
Long Flanking Sequence:
TGTACACCAGTGCCCGTAAACAGATGCTCATATCTGCACTTCCTCCAGTCGTCACTCTTCACCTCAAACGCTTTCACCAGGTCTTTAATAATCTGCACTCATCTTAAGTACTTTAGCTGTCATTTCAGTTTATTTGCAAGCTAAACTCATCTGTTAAAAGTGAATGTAAGGCTTAATGTGATTGAATGCTCATTCGTCTACTTGGACGAAAAAGAAGATCTCTGGTGGGCATTTTAAAAAATCTATAGCAATTTTTTTTTCCACCAAGTGTGTAAAATGCTTCGTTCTTTGCCAATGCTCTTATTGAGTTGTTTGCATCTTTTCAGGCTGGGATGAATCTGAGGAAAGTTAATAGACATGTGGACTTTCCTCTTTTGCTGGACCTGGCACCTTTTTGCTCCGCCACTTGTAAGGTACTGATCAGAGTTCTAGCATTCAAGACCTGTGATTTGTGAGTTTACAGTGTTCTTCCCAATATAGATTTGTTGTTTATGTTTGGC[A/T]GAACCTCGGGTCAGGAGAGCGTGTGCTTTACAGTTTGTATGGCATTGTGGAGCACAGTGGATCGATGCGAGGTGGGCATTATGCAGCCTATGTAAAGGTCCGAACACCTCAACGTAAACCTGAGCAGCGCCGGAACCAGTCAGGTACAAAGCTGCATGGGCAGCATTTCATGCATCAATACATTTTCTTTGCAGCTGGCTCTGAATGGCTTGAATAAAACCTGTGAATAAACAAAGATTGTTTTCATTATGGCATTGGACCTGCATTCACTGCAACCTTGAATAAGTAGCTTGTTCAGTAAAGGCCAAGTGGGTTTTGTTTTTTGTTGATCTATCGATGTGTTCTTCTTCACTCACTACTCAAGGAGAGCGTCTACGTTACAGCATTGTTTGGAAGTAAGAGTAAATGGGCTGTGAGAAGCGATTGAACACACTTTGGTAGTTAACTACTGTTGTGCGCAAATTGAAAATGAATTGTTGCAAGGTTATAATTAAGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28695
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112360 Essential Splice Site 779 830 None 23
ENSDART00000137232 None 751 803 17 18
Genomic Location (Zv9):
Chromosome 16 (position 34993987)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32725487
GRCz11 16 32679517
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCGAGGTGGGCATTATGCAGCCTATGTAAAGGTCCGAACACCTCAACG[T/A]AAACCTGAGCAGCGCCGGAACCAGTCAGGTACAAAGCTGCATGGGCAGCA
Long Flanking Sequence:
GCTGTCATTTCAGTTTATTTGCAAGCTAAACTCATCTGTTAAAAGTGAATGTAAGGCTTAATGTGATTGAATGCTCATTCGTCTACTTGGACGAAAAAGAAGATCTCTGGTGGGCATTTTAAAAAATCTATAGCAATTTTTTTTTCCACCAAGTGTGTAAAATGCTTCGTTCTTTGCCAATGCTCTTATTGAGTTGTTTGCATCTTTTCAGGCTGGGATGAATCTGAGGAAAGTTAATAGACATGTGGACTTTCCTCTTTTGCTGGACCTGGCACCTTTTTGCTCCGCCACTTGTAAGGTACTGATCAGAGTTCTAGCATTCAAGACCTGTGATTTGTGAGTTTACAGTGTTCTTCCCAATATAGATTTGTTGTTTATGTTTGGCAGAACCTCGGGTCAGGAGAGCGTGTGCTTTACAGTTTGTATGGCATTGTGGAGCACAGTGGATCGATGCGAGGTGGGCATTATGCAGCCTATGTAAAGGTCCGAACACCTCAACG[T/A]AAACCTGAGCAGCGCCGGAACCAGTCAGGTACAAAGCTGCATGGGCAGCATTTCATGCATCAATACATTTTCTTTGCAGCTGGCTCTGAATGGCTTGAATAAAACCTGTGAATAAACAAAGATTGTTTTCATTATGGCATTGGACCTGCATTCACTGCAACCTTGAATAAGTAGCTTGTTCAGTAAAGGCCAAGTGGGTTTTGTTTTTTGTTGATCTATCGATGTGTTCTTCTTCACTCACTACTCAAGGAGAGCGTCTACGTTACAGCATTGTTTGGAAGTAAGAGTAAATGGGCTGTGAGAAGCGATTGAACACACTTTGGTAGTTAACTACTGTTGTGCGCAAATTGAAAATGAATTGTTGCAAGGTTATAATTAAGTTTGAGGTCTGCGTAAAAGACTTCTTTAACAGGAGGAGGAGCTGAAAATCCACATTTCGCCTGTGTTTTGGTGTTAAGTGTTTTCTTTTTTATGACTGTTTAAAATGGCGAAATTCAATA
Associated Phenotype:
Not determined