Busch Lab

ZMP

si:dkeyp-94h10.2

Ensembl ID:
ENSDARG00000075008
ZFIN ID:
ZDB-GENE-070912-691
Description:
Novel protein similar to vertebrate PAS domain containing serine/threonine kinase (PASK) [Source:Uni
Human Orthologue:
PASK
Human Description:
PAS domain containing serine/threonine kinase [Source:HGNC Symbol;Acc:17270]
Mouse Orthologue:
Pask
Mouse Description:
PAS domain containing serine/threonine kinase Gene [Source:MGI Symbol;Acc:MGI:2155936]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa8467 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa689 Nonsense Available for shipment Available now
sa15864 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25899
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112217 Essential Splice Site 60 1229 None 19
ENSDART00000132975 Essential Splice Site 60 1229 None 20
ENSDART00000133812 Essential Splice Site 60 174 None 3
ENSDART00000136670 None None 171 None 5
ENSDART00000146439 None None 16 None 2
Genomic Location (Zv9):
Chromosome 2 (position 44574412)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44659913
GRCz11 2 44512911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTCCCTTCAGCGCGAAACTGCACTCTGAGCCGCATGGACACTTCAGG[T/C]GGGCCTGGCGCTTCTGTGGACGCTGAAAACACTGAATGTAATAATGACAG
Long Flanking Sequence:
CATGGTCGCCGAGAACTGAAAAATACTAGTTTATTTCTGAGCAATAGTTTGTTTTATTGTTTATCGTTGCGTTTTATTGTCTAACTAGAAAGAAGGAACAGTCGCCCTTTCTGTCTCCAAGGCAGCAGGCAGTAAACTGAAAGCACAGCAAGAGTGTTGTTGAAGCGAGCAGTGCGGTGGGTGAGTGAGTGAGTGAGTCACCACATATTAGTTTATTCTGCGATATTTTTGTGCACAGATGTTTCGCTTGTCTTGAAAACAATAAGGTCGTCGGTTTGAATCATGTTTGTGACTGTCCGCTTTGATTGAAGCGCATTAGAGATGTGGCTGTCGCACGGCCGGAGGAGCGGCCCCAGTGGCGGCGGTGTTTGTGCTGCTGCTGCTGATGATGATGATGATGGCTGCAGTATCAGCAGTTTGATGAAGAGTGACTCTTTCTGCATGAACCAGTCCTTCCCTTCAGCGCGAAACTGCACTCTGAGCCGCATGGACACTTCAGG[T/C]GGGCCTGGCGCTTCTGTGGACGCTGAAAACACTGAATGTAATAATGACAGCAAATTAGTAAGACAATACAGCAGAAAAACGTCAATACAGTGACTTAAAGGGATAGTTCACACAAAAATGAACATTTATACACTATTTACTGTTCCTCAAGTGCCTTTAAACCTTTGTGAGTTTTTTTTTTCGTCTGCTGAAGACAAAAGAATATATTTTGAAGAATGCTGAACATCTGGATCACATGACTTCCATGTTTATCGTTTTTCCTGCTATAGAAGTTAATGGTCACAGGTTTCTGCTTTAATCAGAATGTCTTTAGTGTTGGACAGAAGAAATAAACTTTGTTTGAAACAAGTAATGGGCTGAGTGAATGATGAAGAATGGAGGTCTGTTAAATGCTGTTCAATGCTTAGAAACCATTTAAAGTATCATTATTATCATAAACCAATAAATCATTATTGAGCATTATTTATTAGTGTACTTATGCCAAAGTAGTCGACGTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8467
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112217 Splice Site, Nonsense 132 1229 2 19
ENSDART00000132975 Splice Site, Nonsense 132 1229 3 20
ENSDART00000133812 Splice Site, Nonsense 132 174 2 3
ENSDART00000136670 None None 171 None 5
ENSDART00000146439 None None 16 None 2
Genomic Location (Zv9):
Chromosome 2 (position 44576004)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44661505
GRCz11 2 44514503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACCRTCAACCCCAATAAAGCTGTYCTCTCYATTAACAGYAGCACATCA[C/T]AGGTATMGGATAATTGTGCTGTTCAAACTCTTTTTTTTTTTTNNNCCCCATTA
Long Flanking Sequence:
TCAGGAGAGAAAATATAGATGTATAAATATAGTAGTTTTTTTGCCACAAAAAGTGTTCTTGGAGCTTTATATGATTACAGCTGAACCACTAATATCACATGGAATGTTTTAACAATGTATTTGTTTAAATTTCTGAACTTTTAACATCTTATGAATGACTGCTGCTGTTATAGAAGACCTGGATTTCATTTTAAAATACGTGTAGTTGAGTAATTATTGTTATTTTGAAGTGAACTAAGCCTTTAATTAATTAATGACTGAAAGTTTATGTTTGGTCTCCAAAAGGTAATTCTCAGGTCAGTTCGTCAGTGGCGATGAGGAATCTTCAGATTTCTGATCTGCAGTGCTCGCTCTCAGTGTCTCCATCATCAGCTGCTGCGTCTCCTGTGTTGGAGAGCTCTCTTCTCAGACAGCTCATCTCTACTGCTCCAGAGAAGAGAAGCACAGCTCTCACCATCAACCCCAATAAAGCTGTTCTCTCCATTAACAGTAGCACATCA[C/T]AGGTATCGGATAATTGTGCTGTTCAAACTCTTTTTTTTTTTTCCCCATTATTTTGGTTACAGGGACTCTATACCTAGTTATTTAGATGTATGCTTATTGATAATGCTATTGATTTTTAAAAAAAATTTTTTGTGTGAAATAAGTTTTATATGGTAATTGAAAAACTTACAAAGCTTACAAAAACAAACAAAAGTAAAGAGCAACCCAAACCCAGCCTCAAAGTATCCAATACTGTGATAATCAAAACAACTTTTTAGTTACAATACATTGCTTAAGTTAATAGAATTCCTCATGAAGTGACAGAAGAAAGGTCCCCAAATTTTGTGAAATTGTCCAATGTTGCCTTTAAAATATCTGGTTCATTCCAATAGGCCTGTCACATTAATCAATATATGGACTTATCATGCAATACCCGGAGATGACCGTTGCAATATATATTTACAAATTCACAAACAAATTTATAGCCATTTTACAATTTTATTTACGTTCTACTTCACTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3399
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112217 Nonsense 268 1229 5 19
ENSDART00000132975 Nonsense 268 1229 6 20
ENSDART00000133812 None None 174 None 3
ENSDART00000136670 None None 171 None 5
ENSDART00000146439 None None 16 None 2
Genomic Location (Zv9):
Chromosome 2 (position 44578709)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44664210
GRCz11 2 44517208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCTGAGGAGATGACTGGCCTGTCGATCATATCTCTGATGCCATCACTA[C/T]AGATCCCTTTCCATTGCAGGACAACACCGAAGGTCACTATCATTTCTTAT
Long Flanking Sequence:
CGAATAATGTTTGCCATAATCAAATTTAGTTACACAAACCTAAGCCTATTAGGTTTGTTCTTGTGTCGATGGATTTCTTTTTTTTTTTTTTTTTTTTGTCTTTTTGCTAAAGTTTCAGAGGAAATAGACTTTTAGTGGAGGTATAGAAAATTCTCAGATTTAATCAGAAATGGATCAATTTATGTTCTGAATATTAACAATTCACTTATGCTTCTGGAATAACATGGAGTTGAGAAATCATTAGTGGATTTTAATTTTGAGGAGATCTAACATTTTAAATGAAACTACTGTGCCTTTCTTATATGGCTTTTTAATATCTTTGTTTAGCAAGTATGCATTCAGGAATGTATTAAATTGATTACACCGGGAAAACAAAGTTATATCTCCTCTTTTCTCAGGGTGGAATCCTCAGTTGTGATGCCACGTTTGCTCATCTCAATGGTTACCAAGCTGCTGAGGAGATGACTGGCCTGTCGATCATATCTCTGATGCCATCACTA[C/T]AGATCCCTTTCCATTGCAGGACAACACCGAAGGTCACTATCATTTCTTATGTGTCACCAACTCTTGCAGCAAACTCCTAGTTAGTTTAGGTTTAGCTAGTTAGTTAGTTAGCAGTCATTGATGCAATAAAATAAGTTTGAATCATGATTATGATCGATTATTTATGATTACATATATCATTAGCCCCTTTCACACAGTGATACCGGTAAATATCCAGAAATTTTCCGGAATGACATTACCGGTATATTCAAAAAAGCACTGTTCACACAGGCGAGGACGTTACGGAAATTTTCCGGAAAAGAGCATTCACACATCCATTCCAAAATACCGGTAAATTCTGACATCATTAACCAGAAATGAGCATTAAACGGCTGCGCTTGTATTTGTAAACATCTGACTAAATTACAAACTCTGTGGATGATCAATATTGTGAACAACTTTCGCAGGATCACTTTTGCATGTCAAGATGTTCATAATATGTGCGTGTGCAGGCGCTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa689
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112217 Nonsense 313 1229 6 19
ENSDART00000132975 Nonsense 313 1229 7 20
ENSDART00000133812 None None 174 None 3
ENSDART00000136670 Nonsense 47 171 2 5
ENSDART00000146439 None None 16 None 2
Genomic Location (Zv9):
Chromosome 2 (position 44586914)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44672415
GRCz11 2 44525413
KASP Assay ID:
554-0597.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCATGTGTCCGCTTGCAGGCCGCTGTGTCCTGTGGACGATCACCACAG[C/T]AGATAAACGGCTCAGGTCATCCTTTATCACTGCATTTCATATCTGGTYGT
Long Flanking Sequence:
ATGTTACAACTTCTCTTTCCGGAAAATATCCAGAACGAATTTACCGGTATTTTCAAAAAGGACCTGTTCACACATACAACCTTTCCGGAAAATTGGCGGTAATTTTCCGGAAAGGTCTGTATGTGTGAAAGGGGCTATTGTTAATTAGAATTTTTTAAATTGTTGTATAGTTTAATATTTCATCGTTTAATATTTAATTGATAATTTCATAGTTTGGTTTAGCTAATTTAGTTCTTTTTTATTTGTTTATTTTTCATTTAATATGTATGTTTTATTTCGGCTTCATTACAATTTACATGCATTTTAGATTACTTTTAGTTCAAGCTAACAACAAAAGCAACAACAACATACCTACTGTGCACCTTCATATAACCTGTTTTCTTCCCATTGTATCTCAGGTGTTGCGTGTGCAGCGGTTGTGTGTGCAGGCCAGGTCTGGTTTGGTGGTTCCAGCATGTGTCCGCTTGCAGGCCGCTGTGTCCTGTGGACGATCACCACAG[C/T]AGATAAACGGCTCAGGTCATCCTTTATCACTGCATTTCATATCTGGTTGTTTTATTGTGCTGCTTCAACAGACAGAAACACAGTCACTTTACTCACTTTGATAAGGAATACTGAAAATAAGATGAAAACAAATATGCAGATTTCTTCCGTTTTCAGCATTCTTCGGGATTTATTCATGACCAGGTTAAATGCATTTCCAATATTTGGTCTGACATTAAAAAAAAAATCTATATTCTCATTGTATTTCTTGTTAGTGTCCTATATAATTTACTAAGTTGCTGACATTTTGTAATTGCACGTATTGATTTTAAATTACATTTCAAATTGCTATTGATTTGAGATTGCTCAGTGTTAGCGTACTCTTGTCCTGCAGGTGGTAAATCAGGTGCGGGAGAACTCCTGTCCCCCAGTGCAGGTGTGCTGTATTCTGGGTCGGTGTGTGTGTTTGCTCCAAGTAGCTGCCTCTTGACGCTCCTGCCCAATGGTACCATTCACAGTCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15864
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112217 Nonsense 659 1229 11 19
ENSDART00000132975 Nonsense 659 1229 12 20
ENSDART00000133812 None None 174 None 3
ENSDART00000136670 None None 171 None 5
ENSDART00000146439 None None 16 None 2
Genomic Location (Zv9):
Chromosome 2 (position 44590258)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44675759
GRCz11 2 44528757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCWCAACAGGGTCGTCAGCATTTGGAAAYGGGCAGCACCTTCCTGGATT[T/A]AAATTCTAACGGAGATGTCATTGTTCATGCCATGTCAGAGATGGACCTGA
Long Flanking Sequence:
GACCACTGCAGATTTTCATGATATGGGTTTCTATCTCAGGTTGGATGACACTACAGAGCTTTGTGAGCAGATTGTGGATGTGGTTCCTCAAACCTCTGGGTCTGATTCTGCCAACTCCACCAACGCTCTGCTACAGACCTTTGCTTTGGTGGAGTCTCTTGAGGTGCAAAAGATCTGCACATCTGCTGATGTTTCTGCTCGTTGTGGCCCATCAGAGCATCACATCGCTGGGCAAGATTCATCAAAGGCCCCAAACCCAGACTGTAAAGAAGCTGCAGTAAACTTCTGTAAATATGCACCAAATCCCCAGTCTCACACACAGACCTGCCTGTGTTCAGATCAAGCCCAGCTTCAGGACTCCAGCTTTGAGGTGATTTCCCTGGGCAGCGGATCATCATCTGGGTTTTGCGAGCGACTCATGGGTGGTTCTGGTCCTGAAAAGCTGGACGAGTCTCAACAGGGTCGTCAGCATTTGGAAACGGGCAGCACCTTCCTGGATT[T/A]AAATTCTAACGGAGATGTCATTGTTCATGCCATGTCAGAGATGGACCTGAACGACAGTGTTGAGATCCCAAATGTCCCTGCGGATCTGAACCATTCGCTTACCTCATGTGACACTGCTGAGCTCCTGCGAACCCCTTCACCCTTCGTTGTAGAGTCAGATGTTGATGAAGCAGCCCCGGTTTGTCCAGAGCAGGAAACAACAACAAAAACACCTGAAGACCAAGAAAGGCCTGCTAGCCCTCAGATGAAGATTCCAGAGCAGCTGCCGAAAAATCATCTAACCAGAGTTCTGGAACAGTGGAGTACCTTTTCAGATCATGCTGTCAGCCGAGTTCTGGACCTCCAAAAGAAAGGAGTGCTGTTGCCAGGCGACGCTCCTGCCACCTCCACCCCTAAGAAGGCCAAGGTGAACTCGTCCATTCCAGAGGGCAGGACACATGTGACCTGCTACAACAGAGATGGAGCACCAATTGGTATGTCAGTGTGGCCTAATTGCTGTT
Associated Phenotype:
Not determined