Busch Lab

ZMP

ap4e1

Ensembl ID:
ENSDARG00000075000
ZFIN ID:
ZDB-GENE-061221-3
Human Orthologue:
AP4E1
Human Description:
adaptor-related protein complex 4, epsilon 1 subunit [Source:HGNC Symbol;Acc:573]
Mouse Orthologue:
Ap4e1
Mouse Description:
adaptor-related protein complex AP-4, epsilon 1 Gene [Source:MGI Symbol;Acc:MGI:1336993]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32509 Essential Splice Site Available for shipment Available now
sa19357 Nonsense Mutation detected in F1 DNA Not yet available
sa11955 Nonsense Available for shipment Available now
sa8426 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32509
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Essential Splice Site 432 1121 12 21
Genomic Location (Zv9):
Chromosome 25 (position 4883640)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4744882
GRCz11 25 4871310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATAACTACATCCTATTGTTGCACGTGAGTTTTTCTATCAAAACCCTTA[C/T]GTTTGCTCCAGACAACTCCTGGTTTATTCAGACCATGAATGATGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19357
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Nonsense 766 1121 17 21
ENSDART00000109284 Nonsense 766 1121 17 21
Genomic Location (Zv9):
Chromosome 25 (position 4890209)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4751451
GRCz11 25 4877879
KASP Assay ID:
554-6224.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGCAAACCAACGACAAACAGCAGCTGGCTTCCTCTTTGTTTGTTGGTT[T/A]GAGTACGCAGAGTTCCACATCTTTGGTGAGAAAATTGTTTTATGAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11955
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Nonsense 766 1121 17 21
ENSDART00000109284 Nonsense 766 1121 17 21
Genomic Location (Zv9):
Chromosome 25 (position 4890209)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4751451
GRCz11 25 4877879
KASP Assay ID:
554-6224.1 (used for ordering genotyping assays)
KASP Sequence:
AACGCAAAYCAACGACAAACAGCAGCTGGCTTCCTCTTTGTTTGTTGGYT[T/A]GAGTACGCAGAGTTCCACATCTTTGGTGAGAAAWTTGTTTTATGAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109284 Nonsense 877 1121 18 21
Genomic Location (Zv9):
Chromosome 25 (position 4892523)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4753765
GRCz11 25 4880193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CRTCTCAGATACTGGGCAGTGATATGGTGATAGTGCGGCCCAACACAATA[C/T]AACACAAKCCGTCCACGTCTTCAGACCTGACCACTCTCTTACCTGCAGAC
Associated Phenotype:
Not determined