Busch Lab

ZMP

CDH19

Ensembl ID:
ENSDARG00000074991
Description:
cadherin 19, type 2 [Source:HGNC Symbol;Acc:1758]
Human Orthologue:
CDH19
Human Description:
cadherin 19, type 2 [Source:HGNC Symbol;Acc:1758]
Mouse Orthologue:
Cdh19
Mouse Description:
cadherin 19, type 2 Gene [Source:MGI Symbol;Acc:MGI:3588198]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16067 Essential Splice Site Available for shipment Available now
sa37802 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114853 Essential Splice Site 69 693 1 11
Genomic Location (Zv9):
Chromosome 24 (position 12604)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15810
GRCz11 24 15810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGATATTTGTTGAAGAGGAAGATTCAACCCCGARGAACATTGGTCAGG[T/C]ATTCATTCACAAGCAGCTCTTACACATACACATGCATACAGGTGCTGGTC
Long Flanking Sequence:
CGTTGTAGTGGTTTAATATATTAAACACCTCGTCTGAACATTTCAGTATGTTTGAATGCAGTCATTTATTTAAGCCTGAGTTGTGTTTTCTGTGGAATTGCTCAGACCTGTAAATCATTCAGACAATCTCTCTCTCTCTCTACTTTGCTTTCCCATAACAGAAGATCTATCATTTCCTTCTCATTGCATTCTTCTTTATGTACTGTCTGAGTCCATCTCCTCCTTTGGCATCTTCAACATGACATCAAGTCCTAGTGTTCACTGAAGGCCCTACTGAAGGATCTCCTCCACAATGGTCCACTGCTGTGTTCTTCGTGTGCTTCTCATGCTTTCCTGCACTCCTGCATGGCCCGCGGCCGTGTTCATCATCTCAGAACAGCAGCAGGAGAAGCTTTTCAGACCAGAGTCTCGTGGGTCCCATCTCAGAGTCAGACGAGGCTGGATCTGGAGCCAGATATTTGTTGAAGAGGAAGATTCAACCCCGAGGAACATTGGTCAGG[T/C]ATTCATTCACAAGCAGCTCTTACACATACACATGCATACAGGTGCTGGTCAAACATATCCATTCAAGAACTAAAGCTGGTGCTGTGTGTACATTTATTCCACACAGACTGATATATTTCAAGTGTTTATTTCTTTTTATTTTTATTGTTTTAATGTCAAACTTCAAATTCACTATCTCAGAAAATTAGATTATTGTGAAAAGGTTGACACTCTTATAGTGACTCTCCACGCTGCATTGCTGCAGTAATACAGGCAGAGGGAGCTCACGCTGGGTATTGAGTGCTGTGCATGCTCAGACTGTCCGTCTTCACACTTCAGTTGGACGAGATTTTTAAAAATCCTGTCTTGAATTGGTCAGAAGTAATCTTGTAATTTTCTGAGATACTGAATTTGGCGTTTTCATTAGTAGTCTACTCATCGATCATCAAAATTAAAAGAAATAAACACTTGAAATATATCAGTGTGTGTGGATTGAGCACGTTAGGCAAGTTTCACTTAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30016
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114853 Nonsense 383 693 6 11
Genomic Location (Zv9):
Chromosome 24 (position 7608)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20806
GRCz11 24 20806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGACGAATGTGGATGAACCACCTGTCTTTTCTGGAACCCCTTATATTTG[G/A]AAAGTTCTAGAAAATGCCCAGACTAGCACACAAGTTGGAACCGTCTACGC
Long Flanking Sequence:
AGATATTGCATGTAGCATGTTCTTCTAACCATGTTAAAGAGGTTTATTATTATGAATTAGATTATAAACCTTGTTTCATTGAAGTATTTAAATATTTAGATATTAAAGCAAACAATATTTTAAAATGAATGTGCTGAGACTGAAACTGCTAATGTTTATTTGTTTTTTCATCATTTATTTTATTCAATATTTGCTTATGGACGTGCGCTGTATTTAAGCAACTAATGTGTTACAATTACATGGAACAAATCAACCAGGAACTGGGTTTGGCAGCTGTATTATTATTATTATTATTATTATTATTTATACGTGTTTTCTCTGTCTCTGCAGCCATTGGATTATGAGAACAAGAGGCGGTTTGTCATTGCGGTTGAGGCCATCAATGAAAACACAGACACACGTTTTCTGAGCATGGATCAATTCAGTGACAGAACCACACTTAAAATCACTGTGACGAATGTGGATGAACCACCTGTCTTTTCTGGAACCCCTTATATTTG[G/A]AAAGTTCTAGAAAATGCCCAGACTAGCACACAAGTTGGAACCGTCTACGCTAGAGACACCGACATCACCAACACTGCCATCAGGTGTGTTTCTCTCCCTTCTATTCTTTCTTCAAACAGTGTGTGTGTGTGAGAGTGTGTGCGTGTGCGTGTGTGTGTGCGTGTGTGTGCGCGTGTGTGTGCGTGTGCGTGTGCGTGCGCGTGTGTGTGCGCGTGTGTGTGCGCGTGTGTGTGCGTGTGTGTGTGTGCGCGTGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCTGAAACAGCCCAGATGATTAGGAACAGGTGGAACAGTGGTCAGTGCAATGGTTTGTGGGAAATGCAGTTGGTGTGGTGAGCAGTACAGGATGAGCTCTGGTGGAACTCCAGCTGTTGATCATAACACTTTTACTGTCAGTGTGAGAGTTGTAGAGAGAGTGTGTGCACTGAATAAAATCTGCATGATATAAAACAGAGGAGCGCAATCCTGTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37802
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114853 Nonsense 517 693 9 11
Genomic Location (Zv9):
Chromosome 24 (position 4898)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23516
GRCz11 24 23516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGATCAGCGCCACTGATGCAGATGATCCTGTGGATGGACAACATTTCTA[T/A]TTCTCCATGATCCCAGACAAGCACATCAACCCCAACTTCACAATCAGAGA
Long Flanking Sequence:
CTTTCCCTAATAATTATCTGTGTTATGAAAGACGCAGACTAGCGCACTTCACCATCCTCCTCACAGTGTTCCTGACCCATCCTGATCTCCACACTGTCATCTGTTATAATCCACGTGACAATAAGCCGCTCTGGTTTTAGTTGAAGCGTCTTTCTTCCATCAACAGTGTGAAAATGATCTGTGCTGTTTTATACCTTGCTGTACTTCAGTGTCATGTGAACCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGGAATCTGGATTTGGGGCACACACAAGATCTGATCCAGAACAGCAAAGCAAAGCATTTCCAGATCTGGCTCTTGTTTAAACACTCACATGTTCTGTGTGTTTCTGACTTCAGCTTATTGAGCTGATCAGCGCCACTGATGCAGATGATCCTGTGGATGGACAACATTTCTA[T/A]TTCTCCATGATCCCAGACAAGCACATCAACCCCAACTTCACAATCAGAGACAACCAAGGTATGTCACAATGTGAGCTTTATAAATGCAGAATATGCAATTTCACTAACACTGAGTCGGGTCCACATTGGTGTTATTTACAAGTCTTTTACAGGTGTAGCTATTCAGACGCAGTGAACTAGAGCAGGGATGCCCAGTGCTGTTCCTGGAGATCTACCTTCCTGTTCCTGAGTCCTGAGATCAGCTCCATTGCTGCTCAAACACACCTAACCCAAGAGCGCTCCTCGGTTCTTATTTGTGCATCCGCATTTCCTCTCCTCATGTCTCAGCTCCACTCTTCAGGATTTGAGGGAAAAACACAAGAACAAAAAGATGCGAAGACGGAGGAGTTAAATCAAGTGAAACACATCGTCTGCTCCTTTCACTTCAAGGCAATCAATTCATCAACACTGTCCATCACTGATGGTGCTTACATTTCTGCATTCTTGAAGAATATAGATGC
Associated Phenotype:
Not determined