Busch Lab

ZMP

si:rp71-15i12.1

Ensembl ID:
ENSDARG00000074974
ZFIN ID:
ZDB-GENE-100922-163
Human Orthologue:
CEP192
Human Description:
centrosomal protein 192kDa [Source:HGNC Symbol;Acc:25515]
Mouse Orthologue:
Cep192
Mouse Description:
centrosomal protein 192 Gene [Source:MGI Symbol;Acc:MGI:1918049]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22766 Nonsense Available for shipment Available now
sa875 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22766
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110803 Nonsense 487 979 11 22
ENSDART00000129691 None None 102 None 3
ENSDART00000144590 Nonsense 530 1168 12 26
Genomic Location (Zv9):
Chromosome 16 (position 11807951)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10323001
GRCz11 16 10213903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAAAAGCAATGTAATTCTGGAGAATTTGCGGAAACATTCTGATGGTTA[T/A]GTGGCCACACTGAGAGGGGTACAGTCTGGGCATGTCAGTAAGCTCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa875
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110803 Nonsense 810 979 18 22
ENSDART00000129691 None None 102 None 3
ENSDART00000144590 Nonsense 857 1168 18 26
Genomic Location (Zv9):
Chromosome 16 (position 11801188)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10316238
GRCz11 16 10207140
KASP Assay ID:
554-0777.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCCATGCTGCCGTGGAATGGACAGATCTATATACAGTGTGGTGATCAA[C/T]AGAAGGTACTAGTTTCCCCCCTTATTTATCAGACATAAAACAAAATGTTA
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
cranium
ZFA:0000737

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
larval locomotory behavior
GO:0008345

disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
liver
ZFA:0000123

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076

aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
trunk
ZFA:0001115
anterior region
BSPO:0000071
bent
PATO:0000617
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084

increased size
PATO:0000586
abnormal
PATO:0000460