Busch Lab

ZMP

GBE1 (1 of 2)

Ensembl ID:
ENSDARG00000074969
Description:
glucan (1,4-alpha-), branching enzyme 1 [Source:HGNC Symbol;Acc:4180]
Human Orthologue:
GBE1
Human Description:
glucan (1,4-alpha-), branching enzyme 1 [Source:HGNC Symbol;Acc:4180]
Mouse Orthologue:
Gbe1
Mouse Description:
glucan (1,4-alpha-), branching enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:1921435]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22590 Nonsense Available for shipment Available now
sa42490 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22590
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113599 Nonsense 279 544 7 12
Genomic Location (Zv9):
Chromosome 15 (position 7430151)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7513697
GRCz11 15 7489768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCCACAGGATCTGGATTTTCTGGGGATTATAACGAGTACTTTGGCCTG[C/T]AGGTGGATGAGGACTCTCTGGTCTACCTGATGTTGGCGAACCATATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42490
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113599 Nonsense 321 544 8 12
Genomic Location (Zv9):
Chromosome 15 (position 7424874)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7508420
GRCz11 15 7484491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTAAGGATGTGTCCGGGATGCCTACACTTTGCTGTCCAGTCCAA[C/T]AAGGAGGTCTGGGTTTTGACTACCGCCTGGCCATGGCCATTCCAGACAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28406
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113599 Nonsense 338 544 8 12
Genomic Location (Zv9):
Chromosome 15 (position 7424821)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7508367
GRCz11 15 7484438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGTCTGGGTTTTGACTACCGCCTGGCCATGGCCATTCCAGACAAATG[G/A]ATTCAAGTGAGTCTCTAGAAATTCACTGTAACATAAAGTAAGAAATGGCA
Associated Phenotype:
Not determined