Busch Lab

ZMP

zgc:162698

Ensembl ID:
ENSDARG00000074967
ZFIN ID:
ZDB-GENE-041111-185
Description:
transmembrane protein 87A [Source:RefSeq peptide;Acc:NP_001082853]
Human Orthologue:
TMEM87A
Human Description:
transmembrane protein 87A [Source:HGNC Symbol;Acc:24522]
Mouse Orthologue:
Tmem87a
Mouse Description:
transmembrane protein 87A Gene [Source:MGI Symbol;Acc:MGI:2441844]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa28472 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7763
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109482 Nonsense 356 583 12 21
ENSDART00000141007 Nonsense 107 333 4 13
ENSDART00000145748 Nonsense 356 583 12 21
Genomic Location (Zv9):
Chromosome 15 (position 28453158)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29171188
GRCz11 15 29104064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAAGATTCATGTTAATTAWTTCTGCCTTTTTGCTATAGGCCGAGACTT[G/T]GAGCRTTGTTGCAYAGAGTGGTCGCTGTAGGATTGCTTTTCCTTATCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28472
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109482 Nonsense 359 583 12 21
ENSDART00000141007 Nonsense 110 333 4 13
ENSDART00000145748 Nonsense 359 583 12 21
Genomic Location (Zv9):
Chromosome 15 (position 28453148)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29171178
GRCz11 15 29104054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTAATTAATTCTGCCTTTTTGCTATAGGCCGAGACTTGGAGCATTGT[T/A]GCACAGAGTGGTCGCTGTAGGATTGCTTTTCCTTATCTTCTCCATCATAG
Associated Phenotype:
Not determined