Busch Lab

ZMP

NDST1 (2 of 2)

Ensembl ID:
ENSDARG00000074936
Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 [Source:HGNC Symbol;Acc:7680]
Human Orthologue:
NDST1
Human Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 [Source:HGNC Symbol;Acc:7680]
Mouse Orthologue:
Ndst1
Mouse Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 Gene [Source:MGI Symbol;Acc:MGI:104719]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39338 Nonsense Mutation detected in F1 DNA Not yet available
sa1058 Essential Splice Site F2 line generated Not yet available
sa19264 Nonsense Mutation detected in F1 DNA Not yet available
sa23986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39338
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Nonsense 136 861 2 19
Genomic Location (Zv9):
Chromosome 21 (position 32432485)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33346922
GRCz11 21 33381144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCGCCTGGAAAAGGTGACATGCCAACACTCACAGATAAGAACCGGGGT[C/T]GATTCACGTTGGTCATCTACGAGAACATCCTCAAGTATGTCAACCTGGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7967
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Nonsense 548 861 11 19
Genomic Location (Zv9):
Chromosome 21 (position 32416962)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33387538
GRCz11 21 33423802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAAAGCTCATGACAGGKCCTGGTTTATGGTTTATGCTTTTGATTTTTA[T/A]CTGGCTAATCCCATAAAGCGGCCACCTCTGGGATGTTATTACCGCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1058
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Essential Splice Site 559 861 12 19
Genomic Location (Zv9):
Chromosome 21 (position 32416500)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33388000
GRCz11 21 33424264
KASP Assay ID:
554-0961.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTGAATTTGCTCGTTTCAGTGAAACTTCATTTCAGCTTATTTCTTACT[G/A]TTTCAGGACCCCTGTGAGGACAAAAGGCATAAAGACATCTGGTCTAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19264
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Nonsense 598 861 13 19
Genomic Location (Zv9):
Chromosome 21 (position 32412075)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33392425
GRCz11 21 33428689
KASP Assay ID:
2261-5852.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGACCTGTTCACTTTCTTCTGTGTTTTTCAGGAACCACTGCCCTCTA[T/G]CTCTTTCTGAGCATGCATTCAGATTTGACCAGTAACTACCCCAGCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23986
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085748 Nonsense 691 861 14 19
Genomic Location (Zv9):
Chromosome 21 (position 32405911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33398589
GRCz11 21 33434853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATCATCACCATCCTTATCAACCCGGCTGACAGAGCCTATTCCTGGTA[T/G]CAGGTCAGTATCTCCGTAACTGCTCGTGTGTCATCTAGTCGCATCCAGGG
Associated Phenotype:
Not determined