Busch Lab

ZMP

abcd1

Ensembl ID:
ENSDARG00000074876
ZFIN ID:
ZDB-GENE-050517-27
Description:
ATP-binding cassette sub-family D member 1 [Source:RefSeq peptide;Acc:NP_001104656]
Human Orthologue:
ABCD1
Human Description:
ATP-binding cassette, sub-family D (ALD), member 1 [Source:HGNC Symbol;Acc:61]
Mouse Orthologue:
Abcd1
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 1 Gene [Source:MGI Symbol;Acc:MGI:1349215]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41121 Nonsense Mutation detected in F1 DNA Not yet available
sa34298 Nonsense Mutation detected in F1 DNA Not yet available
sa21198 Essential Splice Site Available for shipment Available now
sa509 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41121
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Nonsense 46 766 1 10
Genomic Location (Zv9):
Chromosome 8 (position 8591072)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8007654
GRCz11 8 8046239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGAAACTATCCCCGTACTTCTTCGGCAAGCTCAAAGGAAGGACTAGT[A/T]AACAAGTTAAGGGCGCTGACCCGCTTACCTCCAATGGAGAGCCCCTAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34298
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Nonsense 311 766 2 10
Genomic Location (Zv9):
Chromosome 8 (position 8598311)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8014893
GRCz11 8 8053478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGCGTGTGTTTGCGCGCCTGCGTGTGTGCCCTGCGCAGATCGAGATGT[T/A]GCAGCTGCAGCGGAGCTACAACTCGCTGTCCAGGCAGATTAACCTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21198
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Essential Splice Site 367 766 2 10
Genomic Location (Zv9):
Chromosome 8 (position 8598482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8015064
GRCz11 8 8053649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTATGGTTGCTGTGCCTATCATCACTGCCACCGGATACTCTAAATATG[G/A]TATGGATTCAATTATGATTACGATCTGTAGTTCCTGTTCTCATCTTTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7121
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Essential Splice Site 553 766 6 10
Genomic Location (Zv9):
Chromosome 8 (position 8617667)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8034249
GRCz11 8 8072834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GYGTGCTCTACAAACCCTCACCCGATCACATGTTTTACATACCTCAAAGG[T/G]ACYAGCGCTACAWGTAGACYGCATGCTTTGTANNNNTGTGTGTGTGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa509
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111392 Splice Site, Nonsense 672 766 9 10
Genomic Location (Zv9):
Chromosome 8 (position 8626015)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8042597
GRCz11 8 8081182
KASP Assay ID:
554-0228.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGGATGCCGGGATTTCGCTCCTCTCCATTACTCACCGTCCTTCTCTCT[G/A]GTGGGTTTTGAATCGTATGAAAATGAACAGCAGTTCGTTTATTACCAGAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461