Busch Lab

ZMP

si:dkey-200l5.5

Ensembl ID:
ENSDARG00000074858
ZFIN ID:
ZDB-GENE-030131-2310
Human Orthologue:
STARD7
Human Description:
StAR-related lipid transfer (START) domain containing 7 [Source:HGNC Symbol;Acc:18063]
Mouse Orthologue:
Stard7
Mouse Description:
START domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2139090]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12622 Nonsense Available for shipment Available now
sa9576 Nonsense Available for shipment Available now
sa41630 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12622
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
Genomic Location (Zv9):
Chromosome 10 (position 17735344)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17747690
GRCz11 10 17705124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCTATGTGCGTCGATATCAAGTCGACCTAGAGAACAACTTGATGATCT[T/C]AGTCTCAAGGTAAGTGCTGTTGCMAGTTTGTTGTTCACTATTTGTTTATW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9576
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
ENSDART00000112560 Nonsense 282 403 5 8
ENSDART00000147553 Nonsense 244 364 5 8
Genomic Location (Zv9):
Chromosome 10 (position 17735344)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17747690
GRCz11 10 17705124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCTATGTGCGTCGATATCAAGTCGACCTAGAGAACAACTTGATGATCT[T/G]AGTCTCAAGGTAAGTGCTGTTGCMAGTTTGTTGTTCACTATTTGTTTATW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41630
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112560 Nonsense 387 403 8 8
ENSDART00000147553 Nonsense 348 364 8 8
Genomic Location (Zv9):
Chromosome 10 (position 17732600)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17744946
GRCz11 10 17702380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACGACTATGTCAATGTTGTAAAACCTTCTCAACCCTCCCAAGAACAA[C/T]GACTAGGAGCTGAAAACACTCACACTGCAGGCTCAAGTCAGATCTACGCC
Associated Phenotype:
Not determined