Busch Lab

ZMP

si:dkeyp-23e4.3

Ensembl ID:
ENSDARG00000074819
ZFIN ID:
ZDB-GENE-091118-19
Human Orthologues:
DLC1, STARD13, STARD8
Human Descriptions:
StAR-related lipid transfer (START) domain containing 13 [Source:HGNC Symbol;Acc:19164]
StAR-related lipid transfer (START) domain containing 8 [Source:HGNC Symbol;Acc:19161]
deleted in liver cancer 1 [Source:HGNC Symbol;Acc:2897]
Mouse Orthologues:
Dlc1, Stard13, Stard8
Mouse Descriptions:
START domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:2448556]
StAR-related lipid transfer (START) domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2385331]
deleted in liver cancer 1 Gene [Source:MGI Symbol;Acc:MGI:1354949]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43690 Nonsense Mutation detected in F1 DNA Not yet available
sa23999 Essential Splice Site Available for shipment Available now
sa43689 Nonsense Mutation detected in F1 DNA Not yet available
sa29640 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43690
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Nonsense 32 1037 3 16
ENSDART00000138529 Nonsense 22 1030 1 13
Genomic Location (Zv9):
Chromosome 21 (position 34385238)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35384931
GRCz11 21 35419421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGCAAAGGAAGCTTGCGATTGGCTTCATGCGGCTGGCTTTCCTCAGTA[T/A]GCACAGTTATTTACTGGTAAGTATTTACTTTTTTAACATTTCTCGATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23999
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Essential Splice Site 497 1037 None 16
ENSDART00000138529 Essential Splice Site 503 1030 None 13
Genomic Location (Zv9):
Chromosome 21 (position 34383422)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35383115
GRCz11 21 35417605
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCAGAAGCATTTGAATGCACTGCTCAGCCTACAGAGCATACTGATCGG[T/C]AAGAGACACCATTTCATTAAGTCTGTTGAAACAAGTCTTATTCTTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43689
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Nonsense 516 1037 8 16
ENSDART00000138529 Nonsense 509 1030 5 13
Genomic Location (Zv9):
Chromosome 21 (position 34383242)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35382935
GRCz11 21 35417425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAAGAGGTTGCTTGATTTCCTACATTTCAGAATTCAGAGGCCCCACTG[G/A]TCCAGTGCACAGATGCTTTCACTGAGCAGCCCCGGAACAGGCATAGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29640
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Nonsense 607 1037 9 16
ENSDART00000138529 Nonsense 600 1030 6 13
Genomic Location (Zv9):
Chromosome 21 (position 34374235)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35373928
GRCz11 21 35408418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGCTACAGAGTGTCCAGCAGTCGGGGAAGCCTTTGCCACCGAGCATTT[T/A]GAGAGCAATGGAGTTCTTAAGGACCAAGTGCTTAGATCAGGTATGAAATC
Associated Phenotype:
Not determined