Busch Lab

ZMP

si:dkey-11f4.7

Ensembl ID:
ENSDARG00000074800
ZFIN ID:
ZDB-GENE-070912-361
Human Orthologues:
AP005117.2, FAM38B
Human Descriptions:
Transmembrane protein C18orf30 [Source:UniProtKB/Swiss-Prot;Acc:Q8N787]
family with sequence similarity 38, member B [Source:HGNC Symbol;Acc:26270]
Mouse Orthologue:
Fam38b
Mouse Description:
family with sequence similarity 38, member B Gene [Source:MGI Symbol;Acc:MGI:1918781]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa41324 Nonsense Mutation detected in F1 DNA Not yet available
sa6107 Nonsense Mutation detected in F1 DNA Not yet available
sa18490 Essential Splice Site Available for shipment Available now
sa18491 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2535
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758 Nonsense 58 324 2 6
ENSDART00000111349 None None 1532 None 37
ENSDART00000131483 None None 287 None 5
ENSDART00000133933 None None 156 None 3
ENSDART00000134867 None None 147 None 3
ENSDART00000142679 None None 306 None 5
ENSDART00000148338 None None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 82228)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 402282
GRCz11 9 401915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTGGAGCATCTGCTATAACTCCTGGCTGACGTTAGTGWTGCTGGTGTG[G/A]TCGTGTGTGATCTGGATGCTGAAGGACCGACGGCGGTTCGCCATGCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41324
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758 None None 324 None 6
ENSDART00000111349 Nonsense 118 1532 3 37
ENSDART00000131483 None None 287 None 5
ENSDART00000133933 None None 156 None 3
ENSDART00000134867 None None 147 None 3
ENSDART00000142679 Nonsense 181 306 4 5
ENSDART00000148338 None None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 96334)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 388176
GRCz11 9 387809
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATGTGTCCCCCGTCAGATGACTGTCTGCTGCTGCTGGTGGCGTCGCTG[C/T]AGTGGAAGGTGTTCGAGGAGGAAAATCAGGCCTGTGTGAGACTCCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6107
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758 None None 324 None 6
ENSDART00000111349 Nonsense 199 1532 4 37
ENSDART00000131483 None None 287 None 5
ENSDART00000133933 None None 156 None 3
ENSDART00000134867 None None 147 None 3
ENSDART00000142679 Nonsense 262 306 5 5
ENSDART00000148338 None None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 96694)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 387816
GRCz11 9 387449
KASP Assay ID:
554-3755.1 (used for ordering genotyping assays)
KASP Sequence:
CTCATCTTCATCACGGGAACCACCAGGATTAACATGCTGTGTCTGGGTTA[T/A]CTGGTGGCCTGCTTCTACTTCATGCTGTTCGGAGGCACATTACTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27300
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758 None None 324 None 6
ENSDART00000111349 Essential Splice Site 736 1532 None 37
ENSDART00000131483 None None 287 None 5
ENSDART00000133933 Essential Splice Site 84 156 None 3
ENSDART00000134867 None None 147 None 3
ENSDART00000142679 None None 306 None 5
ENSDART00000148338 None None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 109701)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 374809
GRCz11 9 374442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCACGACCAACCAAGCGCTTCTGGATGACCGCTATCATCTACACTCAGG[T/C]CAGCTCGTCATGTTCCAAATGATCATTCATTCATTCATCTGCTTTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18490
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758 None None 324 None 6
ENSDART00000111349 Essential Splice Site 1166 1532 30 37
ENSDART00000131483 Essential Splice Site 224 287 4 5
ENSDART00000133933 None None 156 None 3
ENSDART00000134867 None None 147 None 3
ENSDART00000142679 None None 306 None 5
ENSDART00000148338 None None 177 None 3
Genomic Location (Zv9):
Chromosome 9 (position 117674)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 366836
GRCz11 9 366469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATYTACGCCAACATCTTCATCCTCAAGTGCTGGAGAGAAGCAGAAAAG[G/A]TSCAACTTGACTGTMGGGSTGTGAACAWACACTCAGGATRTCTTAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18491
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109758 None None 324 None 6
ENSDART00000111349 Nonsense 1412 1532 36 37
ENSDART00000131483 None None 287 None 5
ENSDART00000133933 None None 156 None 3
ENSDART00000134867 None None 147 None 3
ENSDART00000142679 None None 306 None 5
ENSDART00000148338 Nonsense 56 177 2 3
Genomic Location (Zv9):
Chromosome 9 (position 123308)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 361202
GRCz11 9 360835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTCTCCAGCAGGGGAACCGCAGCTCCCCAGACAGCGCYCCGCAGTGGT[G/A]GGTGGTGCAGGAGTGCWGGCCCGGACCTCCACCCAGCAGCTGCCGCAGTA
Associated Phenotype:
Not determined