Busch Lab

ZMP

C7U123_DANRE

Ensembl ID:
ENSDARG00000074781
Description:
RPTP-rho [Source:UniProtKB/TrEMBL;Acc:C7U123]
Human Orthologue:
PTPRT
Human Description:
protein tyrosine phosphatase, receptor type, T [Source:HGNC Symbol;Acc:9682]
Mouse Orthologue:
Ptprt
Mouse Description:
protein tyrosine phosphatase, receptor type, T Gene [Source:MGI Symbol;Acc:MGI:1321152]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11104 Nonsense Available for shipment Available now
sa7050 Nonsense Mutation detected in F1 DNA Not yet available
sa15512 Nonsense Available for shipment Available now
sa31544 Essential Splice Site Available for shipment Available now
sa17989 Nonsense Available for shipment Available now
sa15571 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11104
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 378 1496 7 34
Genomic Location (Zv9):
Chromosome 6 (position 51228137)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51277319
GRCz11 6 51277318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGGGAGGGCGGCACTGGACCACCAGGACCACCGCTTATAACTCGCACC[A/T]AATGTGCTGGTAAGTGTCTATATACAGTACAGTACATACTTTGAGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7050
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 634 1496 12 34
Genomic Location (Zv9):
Chromosome 6 (position 51146546)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51195728
GRCz11 6 51195727
KASP Assay ID:
554-4066.1 (used for ordering genotyping assays)
KASP Sequence:
CWAGTTCTTATCAAGTGGTGGTTCAGGAGGAGCGRAAGCAGAAAGTCCGG[C/T]GAGCCACTGATGTTCTGGAGTGTTTCCCTGTTCCCGTGAGCTTCAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15512
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 831 1496 17 34
Genomic Location (Zv9):
Chromosome 6 (position 51084132)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51133473
GRCz11 6 51131491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCCGTAGGCACAGCGGATAAAAGCACAGGAAAAGTCAGCACATTACAC[A/T]AGGACGATCCGYTCTCCACCAGCAACCAGGACCTCAACGGATTCTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31544
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Essential Splice Site 1016 1496 23 34
Genomic Location (Zv9):
Chromosome 6 (position 51019106)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51068584
GRCz11 6 51067803
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGTTTCCCAGGGCTACCACAGACCAAGACACTACATAGCAACGCAAG[G/A]TAATTAACAAAATACATCATCTAAGAGACGTGAACATGGTCTACACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17989
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 1027 1496 24 34
Genomic Location (Zv9):
Chromosome 6 (position 51016175)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51065653
GRCz11 6 51064872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTCCTTGTCTCCTGTAGGCCCCATGCAGGAGACCGTCAGGGATTTCTG[G/A]AGRATGATTTGGCAGGAGAATTCAGCCAGTATCGTCATGGTAACCAACCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26829
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 1188 1496 28 34
Genomic Location (Zv9):
Chromosome 6 (position 50992646)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51042124
GRCz11 6 51041343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATTTTTCCTCTATTGATCTCCATGTGTGTCTTTCTGCAGGAGCAGTA[T/A]GTGTTTGTACATGATGCCATCCTGGAAGCATGTTTATGTGGAAACACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15571
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 Nonsense 216 237 7 9
ENSDART00000108571 Nonsense 1427 1496 32 34
Genomic Location (Zv9):
Chromosome 6 (position 50975530)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51025008
GRCz11 6 51024227
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGGTCAGACGACTGGCCAAATGGCARGAGCAGTATGAYGGAGGAGAT[G/T]GACGTACAGTCGTCCACTGCCTGTGAGTCTGACCTCCACCACACACAGAT
Associated Phenotype:
Not determined