Busch Lab

ZMP

si:dkey-265c15.2

Ensembl ID:
ENSDARG00000074779
ZFIN ID:
ZDB-GENE-030131-4837
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A5A1]
Human Orthologue:
ALMS1
Human Description:
Alstrom syndrome 1 [Source:HGNC Symbol;Acc:428]
Mouse Orthologue:
Alms1
Mouse Description:
Alstrom syndrome 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1934606]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa16006 Nonsense Available for shipment Available now
sa10311 Nonsense Available for shipment Available now
sa11895 Nonsense Available for shipment Available now
sa42141 Nonsense Mutation detected in F1 DNA Not yet available
sa35425 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109126 Nonsense 35 2105 2 18
ENSDART00000140664 None None 1474 None 15
Genomic Location (Zv9):
Chromosome 13 (position 8736144)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9038764
GRCz11 13 9370787
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCAAMAGCATGGACAAAATATACATGATTCAGAAGTTGAWAGACCATA[T/A]GCAGGCCCTGCGAACGATGGAAGACCATTTAATAACCTTCAGGATTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10311
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109126 Nonsense 448 2105 4 18
ENSDART00000140664 None None 1474 None 15
Genomic Location (Zv9):
Chromosome 13 (position 8739599)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9042219
GRCz11 13 9374242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTACKCTCAAACAACATCTAGCAAACCACCAAAGACTGAGCAAACAGTCT[C/A]GCATGCCCATTSTGTYTCAAACGAACACATTTCTCCRGCCRTTTTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11895
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109126 Nonsense 780 2105 5 18
ENSDART00000140664 Nonsense 149 1474 2 15
Genomic Location (Zv9):
Chromosome 13 (position 8740982)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9043602
GRCz11 13 9375625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCGTCGTGGACCAATMAGAGAGCCTGAATTCTCTCCTACTGACTTATG[C/A]ACCATCAAAGGCTCCATAGGAACACCAAYCAAAAGCACACAACCATCWGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42141
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109126 Nonsense 874 2105 6 18
ENSDART00000140664 Nonsense 243 1474 3 15
Genomic Location (Zv9):
Chromosome 13 (position 8741360)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9043980
GRCz11 13 9376003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAACCCTACAACAATCTGATGCTGCAGAAAGTGAAAGGAGCTTTAGTT[T/A]GCCAGTCCCAGAATCAGGGCCTAGAGAAGTGGTAAAAGCGGATGATGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28067
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109126 Nonsense 970 2105 6 18
ENSDART00000140664 Nonsense 339 1474 3 15
Genomic Location (Zv9):
Chromosome 13 (position 8741647)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9044267
GRCz11 13 9376290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGAACCTTTCTCTACTGCTGACCCGCTCTTCATCAGACTCTGCTTTG[A/T]AAGGAAGCTTGTCATCTTCCCAGGGTCCACAGCATATTGACCTGACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35425
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109126 Nonsense 1754 2105 11 18
ENSDART00000140664 Nonsense 1123 1474 8 15
Genomic Location (Zv9):
Chromosome 13 (position 8757661)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9060281
GRCz11 13 9392304
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGTCGCACGTGAAGGAATGAAAAGCGACGGCAGCTTGCTCAGACTTTA[C/A]AACAGCATCAACGCAAAGAAAACAAGTCGAAGGAAACCAAGTACTAAAGA
Associated Phenotype:
Not determined