Busch Lab

ZMP

abca12

Ensembl ID:
ENSDARG00000074749
ZFIN ID:
ZDB-GENE-030131-9790
Description:
Novel protein similar to vertebrate ATP-binding cassette, sub-family A (ABC1) family [Source:UniProt
Human Orthologue:
ABCA12
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 12 [Source:HGNC Symbol;Acc:14637]
Mouse Orthologue:
Abca12
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 12 Gene [Source:MGI Symbol;Acc:MGI:2676312]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa18961 Nonsense Mutation detected in F1 DNA Not yet available
sa9840 Nonsense Available for shipment Available now
sa2502 Nonsense F2 line generated Not yet available
sa41498 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34715 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18961
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 None None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
ENSDART00000109197 None None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
Genomic Location (Zv9):
Chromosome 9 (position 41833750)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40958920
GRCz11 9 40760707
KASP Assay ID:
2260-2246.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAGCGAACATGACAGTCCTGTTAGAGAAAAACAAGTTTATCATGGAC[C/T]AGATCACCACCCTCTCTGTGCTCATGATGAACCTCTCCTCCTGTGTCAAC
Long Flanking Sequence:
ATGCTTTCTTTGTATGTAAATGAGCTTTTATAGATTGAACTTGATGCAGACATTAATACATAATATTTATACATTTATTATGTGGTTTTATATATCATACACTTTTTTTCTATCAGTTTCTTATTTGTAATCGCAAAAACCATGTGATTTGGCTATAAACCATTAGCAGCTTTAAGAACAAACAAACATTAATGACTCACATGGCAATTAAATCACACACCGCCATCTGCAAATCACAAAATCATGCCTCCCTGAGAAATGATCACTTTCCAAATAGGGCATAAGTCTATGAGATCCAAATGTACCTAGCCTCCTCAGGGAAAACCAGCGCAGTTGAGCAGGGTTTTACTGCCGAGCTCTTGACAACTCACGACAACAGCAGGAGAAGTATTGCTCTGTGCACCCAAGCTTGCCTTATCCAGAAATCTGCAGCAGTTATTCTATCTCTTTTCACAGCGAACATGACAGTCCTGTTAGAGAAAAACAAGTTTATCATGGAC[C/T]AGATCACCACCCTCTCTGTGCTCATGATGAACCTCTCCTCCTGTGTCAACTTCGACCGATACCGAGGCTTCAACTCTACTGATGAACTCGACAAGCAAGCCGAAAAACTGGCTCAAAACCGTGAGCTGTATGCCAGTGAGTTTACACACGCACACACAACCTCTTTCTCTCTTTTTCACACACGCACAAACACATACACAAACTCTTTCTCTCTTTTTCACACACGCACAAACACCTAAACAAACTCTTTCTCTCTTTTTCACAGTCACACACACACACACAGGTTTGCTATCCCCATAGATGTAATGGTTTTTATATTGTGCAGACTATATATTCTACCTCGATCCTACCCCTGAACCCAAGCCTTACACAAAACATTCTACAGTTTTACATTTTTAAAATGCTTCATTCTGGATGATTTAGAGTTCATCTGTAAAGTATTCATAGCACTTCAGTTTTCCCATTTTTTTTTTATTTTACAGCCTTATTCCAAAACGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9840
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 None None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
ENSDART00000109197 None None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
Genomic Location (Zv9):
Chromosome 9 (position 41833750)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40958920
GRCz11 9 40760707
KASP Assay ID:
2260-2246.1 (used for ordering genotyping assays)
KASP Sequence:
TCACAGCGAACATGACAGTCCTGTTAGAGAAAAACAAGTTTATCATGGAC[C/T]AGATCACCACCCTCTCTGTGCTCATGATGAACCTCTCCTCCTGYGTCAAC
Long Flanking Sequence:
ATGCTTTCTTTGTATGTAAATGAGCTTTTATAGATTGAACTTGATGCAGACATTAATACATAATATTTATACATTTATTATGTGGTTTTATATATCATACACTTTTTTTCTATCAGTTTCTTATTTGTAATCGCAAAAACCATGTGATTTGGCTATAAACCATTAGCAGCTTTAAGAACAAACAAACATTAATGACTCACATGGCAATTAAATCACACACCGCCATCTGCAAATCACAAAATCATGCCTCCCTGAGAAATGATCACTTTCCAAATAGGGCATAAGTCTATGAGATCCAAATGTACCTAGCCTCCTCAGGGAAAACCAGCGCAGTTGAGCAGGGTTTTACTGCCGAGCTCTTGACAACTCACGACAACAGCAGGAGAAGTATTGCTCTGTGCACCCAAGCTTGCCTTATCCAGAAATCTGCAGCAGTTATTCTATCTCTTTTCACAGCGAACATGACAGTCCTGTTAGAGAAAAACAAGTTTATCATGGAC[C/T]AGATCACCACCCTCTCTGTGCTCATGATGAACCTCTCCTCCTGTGTCAACTTCGACCGATACCGAGGCTTCAACTCTACTGATGAACTCGACAAGCAAGCCGAAAAACTGGCTCAAAACCGTGAGCTGTATGCCAGTGAGTTTACACACGCACACACAACCTCTTTCTCTCTTTTTCACACACGCACAAACACATACACAAACTCTTTCTCTCTTTTTCACACACGCACAAACACCTAAACAAACTCTTTCTCTCTTTTTCACAGTCACACACACACACACAGGTTTGCTATCCCCATAGATGTAATGGTTTTTATATTGTGCAGACTATATATTCTACCTCGATCCTACCCCTGAACCCAAGCCTTACACAAAACATTCTACAGTTTTACATTTTTAAAATGCTTCATTCTGGATGATTTAGAGTTCATCTGTAAAGTATTCATAGCACTTCAGTTTTCCCATTTTTTTTTTATTTTACAGCCTTATTCCAAAACGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2502
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Nonsense 5 674 1 16
ENSDART00000138634 Nonsense 1116 1809 21 36
Genomic Location (Zv9):
Chromosome 9 (position 41794411)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40919581
GRCz11 9 40721368
KASP Assay ID:
554-3014.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCAGGATTAATTTATGCTTTTTTNGTGCTTTGTTTCAGATATGGAGGCT[G/A]GGAGTTTGGAAAGCCTCTTCCCATTGATCTTAAGATGGACATGTTAGAYG
Long Flanking Sequence:
TATCTCCAGCAGAAAAAGACCCTCCACATTATAAGCTACCGATCAGCCCTAAGATTCAGTAAACATTTAAAAACAAATCACTTATGCACCAACTTTCAAGCATGCAATAGACCTAACAGTCCAGTAACTTGCTTTATATCCAAAGAAAATAAATATGCCTCTTCAAGTTGTAAAGAAATCTGTGTTTTTGAAACTAATGAAGACAGCAGAAGTCAAAGATCACAGTTTCTTAAAACATAATATATTGTGTTCAATAGGGAAAAGAGTTGTTGATTTTACCCAGACATTTAAAAAGAATATATTTTAGAGCAGTATACCTATTTTTATCCAAGGTTATCATATGGTCAAAGTCTCATACCGGCACTTGACTGAGCTGTTATTATTGGATCACTGAAAATGCACAGTGGAATTTTCATAAATGTATACAACATGTAAACAGAGTGTTATACCAGCCAGGATTAATTTATGCTTTTTTGTGCTTTGTTTCAGATATGGAGGCT[G/A]GGAGTTTGGAAAGCCTCTTCCCATTGATCTTAAGATGGACATGTTAGATGTGCCAGCAAACAGAACCCTTAGTAAGGTAATTTGGATGAGTGATATAACATTGCCCCAATGGCAAAGTGGCTCATTGTCCCAGCATAGCAGTTTATGTAGACACTAACAGGCTCGGCTCCAAAATCAAGTAAGCTGCCACGTAGGCAGTATTTTAATGCATCATAATCACCCTCCTGATGCGAAAACCGTTTCAAAAGGTAGGCTGCGGAATTACATTGCTTTCGAAAACTAAAACTGTTGAAGCAGTATTGCATGAGTGCTTTAAACATTGCGTTCTTTATGGTGAAAAAAAGAAATTTTTCAAGAGAACAAATGAAACTAAATATCATTCAGTAACAAAAGTTGATTCCAAGCATGCATTTATTATTTTACACAATAGTTATATGTATATTTACACAGTTTAGAATAACAAATTGTTAACTCCTTGATAAATCAGTGTAGCTCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Essential Splice Site 30 674 None 16
ENSDART00000138634 Essential Splice Site 1141 1809 None 36
Genomic Location (Zv9):
Chromosome 9 (position 41794333)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40919503
GRCz11 9 40721290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTAAGATGGACATGTTAGATGTGCCAGCAAACAGAACCCTTAGTAAGG[T/A]AATTTGGATGAGTGATATAACATTGCCCCAATGGCAAAGTGGCTCATTGT
Long Flanking Sequence:
CACTTATGCACCAACTTTCAAGCATGCAATAGACCTAACAGTCCAGTAACTTGCTTTATATCCAAAGAAAATAAATATGCCTCTTCAAGTTGTAAAGAAATCTGTGTTTTTGAAACTAATGAAGACAGCAGAAGTCAAAGATCACAGTTTCTTAAAACATAATATATTGTGTTCAATAGGGAAAAGAGTTGTTGATTTTACCCAGACATTTAAAAAGAATATATTTTAGAGCAGTATACCTATTTTTATCCAAGGTTATCATATGGTCAAAGTCTCATACCGGCACTTGACTGAGCTGTTATTATTGGATCACTGAAAATGCACAGTGGAATTTTCATAAATGTATACAACATGTAAACAGAGTGTTATACCAGCCAGGATTAATTTATGCTTTTTTGTGCTTTGTTTCAGATATGGAGGCTGGGAGTTTGGAAAGCCTCTTCCCATTGATCTTAAGATGGACATGTTAGATGTGCCAGCAAACAGAACCCTTAGTAAGG[T/A]AATTTGGATGAGTGATATAACATTGCCCCAATGGCAAAGTGGCTCATTGTCCCAGCATAGCAGTTTATGTAGACACTAACAGGCTCGGCTCCAAAATCAAGTAAGCTGCCACGTAGGCAGTATTTTAATGCATCATAATCACCCTCCTGATGCGAAAACCGTTTCAAAAGGTAGGCTGCGGAATTACATTGCTTTCGAAAACTAAAACTGTTGAAGCAGTATTGCATGAGTGCTTTAAACATTGCGTTCTTTATGGTGAAAAAAAGAAATTTTTCAAGAGAACAAATGAAACTAAATATCATTCAGTAACAAAAGTTGATTCCAAGCATGCATTTATTATTTTACACAATAGTTATATGTATATTTACACAGTTTAGAATAACAAATTGTTAACTCCTTGATAAATCAGTGTAGCTCAGGAACAGAGCCTTAGACTGACTTTTTTATTACCATTGTGATGGATTGTATTAATATTTGTGTTCACACAGGTTTGGTATAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3714
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Nonsense 62 674 2 16
ENSDART00000138634 Nonsense 1173 1809 22 36
Genomic Location (Zv9):
Chromosome 9 (position 41793751)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40918921
GRCz11 9 40720708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACAGCCTTAACAACTTTTTCCTGAGATCCAGTTTGCCAYCTGAGAAA[C/T]GATATCAATACGGTTAGTTCAATCTCTCAYTAGTACTTTAAAAGTCCWGT
Long Flanking Sequence:
GGCTCGGCTCCAAAATCAAGTAAGCTGCCACGTAGGCAGTATTTTAATGCATCATAATCACCCTCCTGATGCGAAAACCGTTTCAAAAGGTAGGCTGCGGAATTACATTGCTTTCGAAAACTAAAACTGTTGAAGCAGTATTGCATGAGTGCTTTAAACATTGCGTTCTTTATGGTGAAAAAAAGAAATTTTTCAAGAGAACAAATGAAACTAAATATCATTCAGTAACAAAAGTTGATTCCAAGCATGCATTTATTATTTTACACAATAGTTATATGTATATTTACACAGTTTAGAATAACAAATTGTTAACTCCTTGATAAATCAGTGTAGCTCAGGAACAGAGCCTTAGACTGACTTTTTTATTACCATTGTGATGGATTGTATTAATATTTGTGTTCACACAGGTTTGGTATAATTCAGAAGGTCACCACTCTATGCCAGCCTACCTCAACAGCCTTAACAACTTTTTCCTGAGATCCAGTTTGCCACCTGAGAAA[C/T]GATATCAATACGGTTAGTTCAATCTCTCATTAGTACTTTAAAAGTCCAGTGAAATGCTTTGAAATATGCATTTTTATTCAATGTTTGACATAATCTCAACCGAGACAGGAAGAAAGGGTGGGAAAATGTAGCTCCTCCCCTTTTTCAAAATAGCCAATAGCGTTTTGTTTTATCACTGCCAATGAGAGTTGTTGAGCTCAAGCGCATCAGATAAAATGCGTCTTGAAGGGGGCGGGGCATGTCCGTTACTAGAGAGCATTTGATTGGTTGTGATTTGATGAGAAACTGTAGTATGAAGTGAGGTGAATAAAACCATTGATCCATTTAGGCGGAAGTGACAAACTTCAAGCTTGACATTTTTAAATCAGTTTTATCTTAAAAACTAACAATACTGATACTAACATTTAAAAAACCTTATTTTAATTTCATGGGACCTTTTATGGAATGAGGAAACATGTGTGGAGCACATTCATGTATCATACCAAGTGATGCAGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Nonsense 346 674 8 16
ENSDART00000138634 Nonsense 1462 1809 28 36
Genomic Location (Zv9):
Chromosome 9 (position 41778011)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40903181
GRCz11 9 40704968
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCTAATGAAGATGAAGATGTGCTGGATGAACGTCTGCGTGTGGGCCGT[G/T]GAGATGCAAGCTCTGATATTCTGCAGGTTAATCACCTGACTAAGGTGTAC
Long Flanking Sequence:
ATTTTCTTGCTAGTGAACCGCTCAGTTTTTACAAAATCGACCAAGCAAACATTAAATCTCCACTCATTCTGACGCTCGATTTGAACTGCAGCATATCGTCTTGAACATGTCTATATGCCTAAATGCATTGAGTTGCTGTTATGTGATTTGCTGATTAGAAATTTGCGGTAATGAGCAGTTGGACACGTGTACCTAATAAAGTGGCCGGTGAATGTATATGGTTTAAATAGCTCCAAATGCCAGGATTAAGTGTTGAAATCTTTATGGAAATGCATGAAGTGATACACTATGTAATCTTAATGCAATATAAGTGGCTTTAGATAAAAGCATCTGCTAAATGCTTGACTACTAATGTATAAAATTATATATTATATCTTTCATTTTTGGTGCGTTGGTGTGTTCTTCACAGGCGGTTATTCTGCTGGAAGAGGAATGCTGTTCAGAGTTATAGTCCTAATGAAGATGAAGATGTGCTGGATGAACGTCTGCGTGTGGGCCGT[G/T]GAGATGCAAGCTCTGATATTCTGCAGGTTAATCACCTGACTAAGGTGTACCAAAACTTCAGCAAGAGGGTACAGGCGGTGAAGAGTCTGTCTGTGGGCATCCCAGCTGGCGAGGTCTGTGCTATTTGCATATTAATATTCATTATGAGAGTGTTTACATGAAAATCAATATTCCAGTCTAGAGTCAACATGAAATGGAATTTGCAGCCTATTTTATTTTCCTAATTAGATCTATTTCTTATAATCAACATGAATATGATTTGGCGCATTGGGTTTTATTTGATCTGAAAAGTGGATGTTGTGTTGTAGTTCATTTTAATCATATGATCATTTACTTACTTTATTCCAATATCTGTTTATTTCTATTGTTTTTCCTTTGAAATATATAACATTTTCTAACCCTATTTTTTTATAATTATGTTTATTGGGTTTTCACATTAATACAGACATAACAAAACATCTTCAAAAGAAAAATATCAAACAAATCAATGGCGAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8351
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Essential Splice Site 662 674 15 16
ENSDART00000138634 Essential Splice Site 1778 1809 35 36
Genomic Location (Zv9):
Chromosome 9 (position 41761601)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40886771
GRCz11 9 40688558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTCTGCAAATYAAACACTTTTCAGTCAGCCAGACCACGCTGGATGAGG[T/G]AAGATACATAAGCTGTCTAGCAGAAAGAGTTTTTTTTKRTCAATATTTAT
Long Flanking Sequence:
TTTGATAAAATAAGCGTAATCTAGAGGCCTTTGCCTTTCATATAAGCCACTTCTGATATCAAATGATCAACTAGAAGTCAAGTTGACAAATCAAGGCAACAAGACTTTTGCCAGGAAGTGTAGTGTAAATACAAATAGTAAAAGAAGGTGTTTTTATAAAAGTCTTGAAAATGTAAGAGCTTTTTGGGCCAGAGTAACGGTGAAAGTGCTAATAAAAATCACTAAAATTGTTTTGTTGTTTTAAGGAAACACTCACTAAATAACATTATTAGTGATCCTCAGGGAGAGTTAAATGTATGCTGTAACTCCTTGTTTTTTATTTTGCTGTCTAATTTACATGATCCATTTTCTTTCCATAAAGGATAATCATTCCAATATGGTGGAGTATCATGTGCCTGTTGCTCCTGGTGGTGTGGCTTCAATCTTCAGCCTGTTAGAGTCCAACAAGACAGTTCTGCAAATCAAACACTTTTCAGTCAGCCAGACCACGCTGGATGAGG[T/G]AAGATACATAAGCTGTCTAGCAGAAAGAGTTTTTTTTGGTCAATATTTATTATTGATTTATCCTCATGCTGTTTTTCTGTGCAACGCAAAGAGAGATTGTTTTTTTTTTATAAAGATCTACAGCCTTGTTCAGCCATAAAAGAAATATAATAGAATAGAAGTACAGTCCTATATTTAGTGTCTTGAAGACATTTAAATGCTGAAGCTTATTTCTGCCATATAAAAAAATGCAATATGTTACATTTTATTTTTTCTATTTTAGGTTTGCTTTTCTCAGATTTGAATTCTAAACTGATAAATTTGAGTTCATTTGATTCATTTCTCAAATAAAATCATTTAAACTTGATGTTTCAAGAAATAAAGATGAAATTCTGAGATAAGGTTGTGAGCTGTGAACTCTGAGGGAAAGAAATCAGTATTTTGAAATGTAAACAGAATTCGTTGAAAAAAACGTTTCAACTGCGAGATGTAACCTTAAAATGTTGAGAAATAAACATAAT
Associated Phenotype:
Not determined