Busch Lab

ZMP

BRWD1

Ensembl ID:
ENSDARG00000074747
Description:
bromodomain and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:12760]
Human Orthologue:
BRWD1
Human Description:
bromodomain and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:12760]
Mouse Orthologue:
Brwd1
Mouse Description:
bromodomain and WD repeat domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1890651]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa22585 Essential Splice Site Available for shipment Available now
sa17808 Nonsense Available for shipment Available now
sa32013 Nonsense Available for shipment Available now
sa42482 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24974 Nonsense Mutation detected in F1 DNA Not yet available
sa2820 Nonsense F2 line generated Not yet available
sa13081 Nonsense Available for shipment Available now
sa35805 Nonsense Mutation detected in F1 DNA Not yet available
sa35804 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Essential Splice Site 28 2008 1 36
Genomic Location (Zv9):
Chromosome 15 (position 5775720)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5894057
GRCz11 15 5881908
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGTACTGTATCGCCTTTGATCGAACAGGTTCCAGGATTTTTACGG[T/C]GAGCATCAAAAATCTGTTGGACTTCCCTGGGCCTTTGTTTTGGATCTTGA
Long Flanking Sequence:
AATCATGCAGCTCTACTGTCTATGGAAGATGACAGCTCTCAGATTTCATCAAAAATCTCTTCATTTGTGTTCTGAAGACGAAGAAAGGTTCCAGCGTAAGGGTGAAATAATGAATAATTGAATTTTCATGTCTTTGTGAACTAACCCTTTAAAGCAATGAGGATAAAGTATAAGAATACTTCCAGAACCAGCTCTGGTCAACGCGTGGGGTGGCAGTAATGTCCAATCTTATGTATTCGAGTATGCAAATTGGGGCACACTTTCATGACTTCATGTCTTGGCAGAAATGGAGCTTAAACGTCAAGTGTTCTGAGTGGGTTTCCTATCTTTCTTTGTAGTGGAGGTGTGCCGAGGCAGAGAGCTCACAGGAGCCCAGCGCTTCAGCTCCATCAACCCTGTCAGCAATTATCAGCACATGAAGATGCACAGGAGGATCCTGGGACATCTCTCTGCTGTGTACTGTATCGCCTTTGATCGAACAGGTTCCAGGATTTTTACGG[T/C]GAGCATCAAAAATCTGTTGGACTTCCCTGGGCCTTTGTTTTGGATCTTGACTAGAGATAATAATGATTAATCACTGATCAATAACCAAGATCTATTGATGGGATTAAAGGATTAGTTATTTTCGGAGTGAAAATTTCCTGATTATTTGCTGAAGGACAAAGTATTATTGACTCTGACCGAATTCAGAGTTGTAGGTAAAGTCTAAAAGGGAGATATCTGTGGCTGGAAGTTAATAAGAATTATTTTTATTATTACAGTAATACAACAATAATTACTGTTTTTGCTTGGGTTTAGAGTTGGGGTGGGGGTAGATGTTAATAAAATACAATTAATGGGAAATGTAATAAATAATATAAATAATTCTAGTTAACATCTGGCAGCAGCTGTATTCCTTCTAGCAACAACCAGGATAGAATTGTTGTTCATAACTCATCCAGTTGTTCTTGTCATTGCAAGTCTGTAAGCTCAAACTACATCTAAATTAGGTTGTTTCATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17808
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 227 2008 7 36
Genomic Location (Zv9):
Chromosome 15 (position 5762980)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5881317
GRCz11 15 5869168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGTAGTCGAGATGGCACTGCCCGCATATGGAGACTGCATCAGAGACAT[C/T]AGTGGAAGAGCGTTTTATTGGACATGTCTGCCACTCTTCCAGGGTATGGA
Long Flanking Sequence:
TTGTGACTGTTTACAGTTTCATAATTTCCATATATTAAGATATGCTGCAGAAAAATTGCATTGCATTTAATGCAGTGCTGCTTGTTTGGTCTTATACCCACTTTATATTGTATCTCAGTCAGGCAGTGATGACCACTGTTTTATAAAGAAATTAGATCTTTGACGCAGAAATTTTTGTATGGGATAACAATTCACTGAAATTAAAATGTGTGTGCAAATACCCCATTAGCACTCAACTGACACACAACATACATTATAAACTACAACAGACAAACATTTGAGAAGTATGGATGTTAGAGCTTGGCTATAACAAAATCAATTTCTCTCTTTTTTTTTTTATTCAATCTTCATTGTGATGAACTCAAATCTTTTAGTATGCTGTGTTCATATAATGTATGGCTAAAATAACAAGACGGTAAAATAATTGTGTGATTTGTCTTAGGTTTGTGAGTGGTAGTCGAGATGGCACTGCCCGCATATGGAGACTGCATCAGAGACAT[C/T]AGTGGAAGAGCGTTTTATTGGACATGTCTGCCACTCTTCCAGGGTATGGAATAATGAACTCCAGCAGGTCATGGCACTTTTAACCAATCATTAATGAAGTTGCACCTTTTTTTTTTGTTTAACACAGGTCTGCACCTTTAACAGACGATGAAAATTTCTTCAAACCCAAAGTGACCATGGTGTCCTGGGATCGCCACGACAACACAGTCATTACCGCCGTCAACAATCATCTCCTCAAAGTGTGGAACTCCTACACTGGACAGCTGCTGCACGTCCTTAAAGTACGACTGCGCAGATCTGAAGATGTAGCTGAAGGAGAAGTTCACCGAAAAAATACTGTTCATTTTCCTGAAATAAAGCTCAAACTGTCTTTCAGCTTGGCAAACCTCTTGATCCATTTTCTTGCAAATTCAGTAGGCAGCCAATCAGTAGTTTTAAATTCTTGAGAGGTTTTCCTGGTTCGTGTAGAGTATGTTTAGTGAACTCCCTGAAATGACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32013
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 306 2008 9 36
Genomic Location (Zv9):
Chromosome 15 (position 5762372)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5880709
GRCz11 15 5868560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCGCAGGGTCATGAGGCGGAGGTGTTTGTTTTGGAGCCGCATCCCTA[T/A]GACCCTCGCATCATGCTCTCTGCTGGTCATGATGGCAATGTCTTTGTATG
Long Flanking Sequence:
TTTTTTTTTGTTTAACACAGGTCTGCACCTTTAACAGACGATGAAAATTTCTTCAAACCCAAAGTGACCATGGTGTCCTGGGATCGCCACGACAACACAGTCATTACCGCCGTCAACAATCATCTCCTCAAAGTGTGGAACTCCTACACTGGACAGCTGCTGCACGTCCTTAAAGTACGACTGCGCAGATCTGAAGATGTAGCTGAAGGAGAAGTTCACCGAAAAAATACTGTTCATTTTCCTGAAATAAAGCTCAAACTGTCTTTCAGCTTGGCAAACCTCTTGATCCATTTTCTTGCAAATTCAGTAGGCAGCCAATCAGTAGTTTTAAATTCTTGAGAGGTTTTCCTGGTTCGTGTAGAGTATGTTTAGTGAACTCCCTGAAATGACAGCTATTCATTTAAAAATAGAATGATATGTGATATAAAGCTGAATGGCTCTCTCTTTACTTGCTCGCAGGGTCATGAGGCGGAGGTGTTTGTTTTGGAGCCGCATCCCTA[T/A]GACCCTCGCATCATGCTCTCTGCTGGTCATGATGGCAATGTCTTTGTATGGGACCTCATCAAGGGCACCAAAACCATGCATTACTTTAATATGGTAGAGTATCCTAATGATCTTTTAACCTTTTTTATTTTTGTAACTTTTATTTGCAGGCACTCTTAGTGCTCTCAAAATTGTGGGGGGCGCAATGCAGTTAGAACTCAAGGTGCACGAATAGTGTGCAAAATGCTCGCAGGCAATAGGCATAGGGTCGCTGGCTTTTAAAAAACATTTTTTTACAAAGTTGCCTCTCAACTAGGGATGCACTGATCTTGATTCTTGGATCGGATATTGCTTCGATACTGTATATTTTTGCTGGATCGGGTATCGGCCAGCTGGCACCGATCCAAATCCGATCTTGCTCGTGCGCTATATTCAGTGCAGTTTATAAGCCAACAAAAGGTAGCCTATTACCATAGATATGTACATTAGATGTCGCCTGGCCTGTTGTTGTCTATTGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Essential Splice Site 456 2008 11 36
Genomic Location (Zv9):
Chromosome 15 (position 5758905)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5877242
GRCz11 15 5865093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATATTGCAGATGAGCATCTTGTTCCTCAACTTGGCTATGTTGCTACAAG[T/A]AAGTGTTGTCATAACAGTGTTGTCCATGTTTCTCTGTTGACTGCTTTGGC
Long Flanking Sequence:
CAATTATAAACATGCTGTTTTTTCTGTTGTGCAGATCGAAGGTCAAGGACATGGTGCTGTATTTGACTGCAAGTTCACCCCTGATGGCCATCGCTTTGCGATGACAGACTCTCATGGACATCTGGTTATTTTTGGCTTTGGAAGCTCCAAGCCTTATGAGAAGGTTTGTTTGATTTTATAATCGATAAAACTTTTTTTTTTTACCATGCCAGATCATATAAAGTACCTTAGTGTAATTCCTCAAACCTCTGATCTGTCCAAAATGATTTGTAGCTTCCAGACCAGGTGTTTTTTCACACCGACTACCGGCCGCTGATCCGGGACACCAATGGTTTTGTTCTGGATGAGCAGACCCAGCAGGCACCACACCTGATGCCGCCTCCCTTCCTGGTTGACGTGGATGGAAACCCTCACCCTCCCAGATTCCAAAGACTGGTCCCAGGAAGAGAAAATATTGCAGATGAGCATCTTGTTCCTCAACTTGGCTATGTTGCTACAAG[T/A]AAGTGTTGTCATAACAGTGTTGTCCATGTTTCTCTGTTGACTGCTTTGGCATAGCCACAACGTTCACTGTAAATATTACACAGAAGAACCATTTTCAAAACCAGTTTTCTTTTGTATTAACCGTTATACACATAAGATCTTAGTCTGCCATTGCCTTAGGGCTGCACGATTAATCGGAAAAAGATTGCGAACTTGATTCGACTTTACACAAATTTTAATTCAGCTTTTTTACGATTCAGCCAATCAAATTTTAAGGTCAGGTGGGAAGCGTAAAGACGGTCACACAAGTCTTAACATTGTTTTATATACGTTGCTTACCAGCATGGACACCTCCAAATGGTGTTACAAGTGTCACATTCTGTATTTATAAGGAACAATTCACCCCAAAATGTCATTTCTATCTTAATGTAATGAAGTAGTTGCGGCCGCAAAATCACACATGAGCTGACGCACTGTTTGTTTACTACCAATGATGTCTACTTAAGTGAACAGAACCTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28402
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Essential Splice Site 757 2008 18 36
Genomic Location (Zv9):
Chromosome 15 (position 5744176)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5862513
GRCz11 15 5850364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATGGAAGTTAAAAAAATAACAAATTGATATATATTTTTTTATTCTTA[G/T]CACTCTAAACCAAGGCCATCCATTAACAGAGAGATATCGAATGAGTTCCG
Long Flanking Sequence:
GAAGGGCTATGCGTCAGCGCCGTAGCATACGCCGGCGTTTGACGCAGAAGTATAAATGGCTGCTGTCCATTTGGTGTGTTCATGCACAGCTTTTTTGTCCAAACATAGTTGGCTTTCGTTAATGCTTGTTGCTTGGCGTCAGCCTGATGTGTCCCAGACTTTACAGTAGACATGGACATAAATGCATACCGTTCTTTATAGAACCATACCACTAAGTAGAACAGGCCATAATTATCGACTTTGTATAAGCGCCAAATAGACTCAGTTACAGCTCTGACCTTTAGCACTACAGTACTTGTGGCAACCCAAGTTTGAGTGCCAAATCAAGGTCTCTGCATCCCATGCTTTCCTGTCTCCTAAAATTTAGGGAACAATGTATGAAATTGGTACTGAAGATTGTTTTAAACTCTTGAAATATTGTTTTTGACTAGAACTCAGTCTTTGTCTGTTTTCATGGAAGTTAAAAAAATAACAAATTGATATATATTTTTTTATTCTTA[G/T]CACTCTAAACCAAGGCCATCCATTAACAGAGAGATATCGAATGAGTTCCGTCCTCCAGCTTGGATTACTGACGTTGTTCCCCGAAAGTCCCCATTTGTCCCTCAAATGGGAGATGAGGTATAGAATAAGATTCTCTCATCTCATCTGTATTAATGTGCAACTGACACGTGTCTAAAACCCACTGTTGTTGTTTTTATATCCATTGTTTTGGACGTAGGTCATCTATTTCCGTCAGGGTCATGAGGCATATGTGGATGCAGTCTGTCGCATGAACCTGTACCCAATAAACCTAGACAAACAGCCATGGAAGAAGATGCAGTTAAGAGTAAGAGCAAAAAATGCTGGGGTTTTACCAAAATTATTTATTTTTTAGAGGTATAGAGTTAAAAAGTCAAGGTAAAGAGTTAATGGAACACTCCAAGTTTTTGGAAATAGGCTAGCAATAGGGAATCGATGCTATACATTCTCATAGCATCTCATAGCACCTAATCTTTGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24974
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 833 2008 20 36
Genomic Location (Zv9):
Chromosome 15 (position 5743643)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5861980
GRCz11 15 5849831
KASP Assay ID:
554-7870.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTAATCTTTGACTTTTAAAATCATAAATCATGTTTTTTTTCCAGGAC[C/T]AAGAGTTTGTGAAAATAACAGGGATCAAATATGAAGTTTGCCCTCCAACA
Long Flanking Sequence:
GATATCGAATGAGTTCCGTCCTCCAGCTTGGATTACTGACGTTGTTCCCCGAAAGTCCCCATTTGTCCCTCAAATGGGAGATGAGGTATAGAATAAGATTCTCTCATCTCATCTGTATTAATGTGCAACTGACACGTGTCTAAAACCCACTGTTGTTGTTTTTATATCCATTGTTTTGGACGTAGGTCATCTATTTCCGTCAGGGTCATGAGGCATATGTGGATGCAGTCTGTCGCATGAACCTGTACCCAATAAACCTAGACAAACAGCCATGGAAGAAGATGCAGTTAAGAGTAAGAGCAAAAAATGCTGGGGTTTTACCAAAATTATTTATTTTTTAGAGGTATAGAGTTAAAAAGTCAAGGTAAAGAGTTAATGGAACACTCCAAGTTTTTGGAAATAGGCTAGCAATAGGGAATCGATGCTATACATTCTCATAGCATCTCATAGCACCTAATCTTTGACTTTTAAAATCATAAATCATGTTTTTTTTCCAGGAC[C/T]AAGAGTTTGTGAAAATAACAGGGATCAAATATGAAGTTTGCCCTCCAACATTATGCTGTCTGAAACTGACCCAGATTGACCCTGGAACTGGCAAAATAACAGACCGAACCTTTTCAATAAAGTAAGTTGATAAGATATGGTGTATATTAAGTAAATGTTGGCCATCTGATAAACATTTGGTTTTTGATAAAGCTTAGTTTTAAACACATTTTTTTCAATTCTTAGATATCATGATATGGCAGACGTAATAGATTTTCTGGTATTACGTCAAAGCTACGATGAGGCGCGAAACAGAGTGTGGACTTCGAGTAAGTTGGAAGAATGACCTGAGAATAACTACATAGTTGTACCGTGCATCAATTTAACCATTGAGTAATTTAGAGAAATATAATCTGTCTGTTCTGATGTTCATGCTGTGGTTCTTCTAGATGACCGTTTTCGCTCTGTGATCGATGACGCCTGGTGGTTTGGGGCCATAGTTTGTCATGAGCCATATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2820
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1006 2008 24 36
ENSDART00000115034 Nonsense 1006 2008 24 36
Genomic Location (Zv9):
Chromosome 15 (position 5739046)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5857383
GRCz11 15 5845234
KASP Assay ID:
554-3264.1 (used for ordering genotyping assays)
KASP Sequence:
GGGACAGGGGTCGGGAACAAGAGAGCSCRCGCATCATTGCAGGAATAGAG[C/T]AGCTTATGACTGTGGGTATGTTTGATTTTGCTATTACACTCTTTGTTTTT
Long Flanking Sequence:
TATTGGCTCGTTTGACTCATGCTAGCAAACTGGGCTTACTTTGTTCTATGCTAGCAATAATTAGCAACAATTAGCTAAATGCTATAACATGCTAAAAATGTTTACAAACTATTAAGGTTTGATTAAACATGTAAATGAAGCTTGCTAATTAACAACCTAGTGTATCCTACCAGGTGCCTAACAATCACTCACTATCTAGCAACCACCTAGCATGTTGGCAACCACTGCGCTTCCTGCCAGCTGTCTGGAAGGTCCGAGCGTAGTCATGTTGTCTTTCTCAAGCCAGCATCAAAGTTTGTCAAGCAACTTTAGCTATAGTTTGAGTAACTGTTCATTCAGGATTGGCTCTTTATTTTGCAGCTGAACAGCCGGAGTCGGCGAGTGCTGGAGTACCAGTGACAGATGAGGAGATGATGGATATCCTGTATAAACCTCAAAGGGGTGAATGGGGGGACAGGGGTCGGGAACAAGAGAGCGCACGCATCATTGCAGGAATAGAG[C/T]AGCTTATGACTGTGGGTATGTTTGATTTTGCTATTACACTCTTTGTTTTTTGCTTCTAGTTTTTACATGAACACTTTTTAATTTTGTCATTTCGGCAAGGAGTTGTCAAGATTTTACTCACCATCATGTCATTTCAAACCCATCAGACTTTTGTTAATCATTAGGACACGGATACTTTTTTAAATGTGTTCAGTTTTAGTTTTTGCTCATCCATTCATAGTCCATGTATTTAACATTATGAATATTACTTAGTTGGTGTAATTTTGTCTGAAAATGGAGGTCGTAACAGCAAACTCCACTGGTTCTCTCTAGTCAAGCACATGTTTAGAGCTGCTGTTTATCTTTTATCATGTGCAATGCAGGTTGATCAATGTTTACATGACTGAAAGCCTAAATTAAAAGGTTTTGTCTGTCCAGTATTTAAAGTTACTGTGATAATATTATTATTATTTATTTTTTTTAAACGAAATTTTTAAGGATTTTAAAGTATGGACAAAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5614
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1006 2008 24 36
ENSDART00000115034 Nonsense 1006 2008 24 36
Genomic Location (Zv9):
Chromosome 15 (position 5739046)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5857383
GRCz11 15 5845234
KASP Assay ID:
554-3264.1 (used for ordering genotyping assays)
KASP Sequence:
GGGACAGGGGTCGGGAACAAGAGAGCSCRCGCATCATTGCAGGAATAGAG[C/T]AGCTTATGACTGTGGGTATGTTTGATTTTGCTATTACACTCTTTGTTTTT
Long Flanking Sequence:
TATTGGCTCGTTTGACTCATGCTAGCAAACTGGGCTTACTTTGTTCTATGCTAGCAATAATTAGCAACAATTAGCTAAATGCTATAACATGCTAAAAATGTTTACAAACTATTAAGGTTTGATTAAACATGTAAATGAAGCTTGCTAATTAACAACCTAGTGTATCCTACCAGGTGCCTAACAATCACTCACTATCTAGCAACCACCTAGCATGTTGGCAACCACTGCGCTTCCTGCCAGCTGTCTGGAAGGTCCGAGCGTAGTCATGTTGTCTTTCTCAAGCCAGCATCAAAGTTTGTCAAGCAACTTTAGCTATAGTTTGAGTAACTGTTCATTCAGGATTGGCTCTTTATTTTGCAGCTGAACAGCCGGAGTCGGCGAGTGCTGGAGTACCAGTGACAGATGAGGAGATGATGGATATCCTGTATAAACCTCAAAGGGGTGAATGGGGGGACAGGGGTCGGGAACAAGAGAGCGCACGCATCATTGCAGGAATAGAG[C/T]AGCTTATGACTGTGGGTATGTTTGATTTTGCTATTACACTCTTTGTTTTTTGCTTCTAGTTTTTACATGAACACTTTTTAATTTTGTCATTTCGGCAAGGAGTTGTCAAGATTTTACTCACCATCATGTCATTTCAAACCCATCAGACTTTTGTTAATCATTAGGACACGGATACTTTTTTAAATGTGTTCAGTTTTAGTTTTTGCTCATCCATTCATAGTCCATGTATTTAACATTATGAATATTACTTAGTTGGTGTAATTTTGTCTGAAAATGGAGGTCGTAACAGCAAACTCCACTGGTTCTCTCTAGTCAAGCACATGTTTAGAGCTGCTGTTTATCTTTTATCATGTGCAATGCAGGTTGATCAATGTTTACATGACTGAAAGCCTAAATTAAAAGGTTTTGTCTGTCCAGTATTTAAAGTTACTGTGATAATATTATTATTATTTATTTTTTTTAAACGAAATTTTTAAGGATTTTAAAGTATGGACAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13081
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1220 2008 30 36
Genomic Location (Zv9):
Chromosome 15 (position 5733082)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5851419
GRCz11 15 5839270
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAGACGTTTGTAAGGACATYAGGCTTATTTTTGCMAATGCTAAAGCCTA[T/A]ACRCCAAACAAACGGTCWAAGGTAATGCAAGCATATATTTAGTCTCTTTC
Long Flanking Sequence:
GTAAACAATACAATTACATTAAGGATAGTAAAACTGAATTTTTCACCGTACTGAATGTTTTACAATTTACTTTCATTCAGCTGATTATTTCTTCCTTTTATTTTTAATAAAATTACAGCTTCTAAGTTCTGCTAGTTAAAACCAAAAGCCTCTTGCAGTACTGTTTCTGTATTTGGAAAGCAAATGACATTTGTCGTCTCCTCTTTTTGACTGATGCGAAAAGTGGTCCAATCCGTGACTAAAAAAACATAACGTGATCCGAACTGTGAGATTTATGATCCATTACACTACTAGTGACTTGTTTATCCTGCATTTTAATGTAGTTATATTAGGTAAATCTTTATAATAATGTGTCTGAAATGTCTCCAGGATTACACTAATATAATTGACACTCCTATGGACCTTGGAACTGTGCGCCAGACTCTTGAAGAAGACCGATATGAAAACCCAATAGACGTTTGTAAGGACATCAGGCTTATTTTTGCCAATGCTAAAGCCTA[T/A]ACGCCAAACAAACGGTCTAAGGTAATGCAAGCATATATTTAGTCTCTTTCTGCTTATTCTTCATGTTTGTTAAGTCTCATTGATATTGATGGTGTTTTACAGATTTACAGTATGACTTTGCGTCTGTCCGCATTTTTTGAGGAGAACATACGCAAAATAATTTCCGACTACAAGACTGCCATCAAAAGTAGCTTGAAGCTACGGCGCAGTCAGAGATGCAGGAAGAAGTCGCAACATCAGGAGTCTGTTTCTTTCAGCCAAGGATCCACACGGTAGGCCTGATCGCAGTGCCTTTTTACTTTTATTTTTCCCATGAGTTGTTGCATGCAGACGATGATAAACATCCTTCTCCTTACCTTAGTCAAAAGAGGGCTACTATAAAAACTCAGGAAAACACAGAACAGTCTACAGCCAAATCTACCTCAGCCAAAGTGTCTGGACCAGAGCGTCGCAGAGCCCACGAAGCCAAGGAAACCTTCAGACGGAGTAGCTCATCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35805
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1250 2008 31 36
Genomic Location (Zv9):
Chromosome 15 (position 5732911)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5851248
GRCz11 15 5839099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCTGTCCGCATTTTTTGAGGAGAACATACGCAAAATAATTTCCGACTA[C/A]AAGACTGCCATCAAAAGTAGCTTGAAGCTACGGCGCAGTCAGAGATGCAG
Long Flanking Sequence:
TTTGGAAAGCAAATGACATTTGTCGTCTCCTCTTTTTGACTGATGCGAAAAGTGGTCCAATCCGTGACTAAAAAAACATAACGTGATCCGAACTGTGAGATTTATGATCCATTACACTACTAGTGACTTGTTTATCCTGCATTTTAATGTAGTTATATTAGGTAAATCTTTATAATAATGTGTCTGAAATGTCTCCAGGATTACACTAATATAATTGACACTCCTATGGACCTTGGAACTGTGCGCCAGACTCTTGAAGAAGACCGATATGAAAACCCAATAGACGTTTGTAAGGACATCAGGCTTATTTTTGCCAATGCTAAAGCCTATACGCCAAACAAACGGTCTAAGGTAATGCAAGCATATATTTAGTCTCTTTCTGCTTATTCTTCATGTTTGTTAAGTCTCATTGATATTGATGGTGTTTTACAGATTTACAGTATGACTTTGCGTCTGTCCGCATTTTTTGAGGAGAACATACGCAAAATAATTTCCGACTA[C/A]AAGACTGCCATCAAAAGTAGCTTGAAGCTACGGCGCAGTCAGAGATGCAGGAAGAAGTCGCAACATCAGGAGTCTGTTTCTTTCAGCCAAGGATCCACACGGTAGGCCTGATCGCAGTGCCTTTTTACTTTTATTTTTCCCATGAGTTGTTGCATGCAGACGATGATAAACATCCTTCTCCTTACCTTAGTCAAAAGAGGGCTACTATAAAAACTCAGGAAAACACAGAACAGTCTACAGCCAAATCTACCTCAGCCAAAGTGTCTGGACCAGAGCGTCGCAGAGCCCACGAAGCCAAGGAAACCTTCAGACGGAGTAGCTCATCTTCTTCTGGTAAGACAGAATTATCATTTCAGTTTTAAATTCCCAGTCTGTTTTTTTTTTAATTGGTCTAGATCAGGGGTGCTCAAACTCGGTCCTGGAGGGCCAGTGTCCCGCAGATTTTAGCTTCAACTTCCCTTAACACACCTGCACGGATGTTTCTAGAAAGCCTAGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35804
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1339 2008 33 36
Genomic Location (Zv9):
Chromosome 15 (position 5731070)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5849407
GRCz11 15 5837258
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAAGTACTAATTTTTGCTTTAAACACAGGATCTGATCAGGACAGCAAA[C/T]AGTCTTTGAGTCAGTCAGATGAGGATGATGAACATTCGTCTTCATCACGT
Long Flanking Sequence:
ATACGTGAATCAGAAACATTTCCATTCAATAAATGTGCAAATAAAATATGAAGCAGAGACTTATTAATGATTCCTACTTGTCTTCCTCGTGATGAAGAGTAGGCAAAATCTGCTATGTAGCGGTGGGAAAAAAAAAAGAATGAGTTCAGACGCTGGATTCGAACCGAGTTCATGCTCGAACATGTCAAAACATGCGTTTTAAAAGCTACACCACTCACGCTGTCAAAGAACATACAACATTTTACACCTATAGATCGGACCATTTCTTTTTTAATTTACTATCCACCAACAAAAGAAAAAAAATAGAGTGGGAGAGTTTAGCTGATGTGGTTAACACAGTTGAGTGAGCCCAATTCAGAGCACTCACACTTCTCAGACGAATCAGGAAACGTGCCTGGGTTCGGTTTGGATAGCATAGTGTGAGTGCACACTTTGGGATCTGTAATGTATGTCAAGTACTAATTTTTGCTTTAAACACAGGATCTGATCAGGACAGCAAA[C/T]AGTCTTTGAGTCAGTCAGATGAGGATGATGAACATTCGTCTTCATCACGTGCCATGAGACGCGAGACTAGGGCCACAAGAAAAAAAGCTGCACAGAATAAAGGAGCGAAATCAAGAAGACCAGGTGAGGTCCTTCAACCTATCTATTTAATTATTTGTGTTGTTGTGCTGCTGAGTGACATTTCAAGCACTTTCAGATGTTTCCAACTTGTTGCAAATGTAGCCAGATGTTAATATATGTGATTGTGGACCACAAACCTACTTTAATGTTGCATGAGTATACTTTTAATAATAGCAAAAAATGCATTGTATGGGTCAAAATTATCCAAAAACTTTTTGTGAACCCTCAAATTCCAGACTTCTATTATCGGCCAATTATATTACTGTTGTGTATCCACCAAAAACTATCCTATTATAAGCCATACATTAATTGAAAGCGTATTTATTATTTTTTTCAGGTATAAACCTCAAGAAAATCAAACGCACTTATGACACTTATTG
Associated Phenotype:
Not determined