Busch Lab

ZMP

zgc:163016

Ensembl ID:
ENSDARG00000074730
ZFIN ID:
ZDB-GENE-060810-80
Description:
membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase [Source:RefSeq peptide;
Human Orthologue:
PKMYT1
Human Description:
protein kinase, membrane associated tyrosine/threonine 1 [Source:HGNC Symbol;Acc:29650]
Mouse Orthologue:
Pkmyt1
Mouse Description:
protein kinase, membrane associated tyrosine/threonine 1 Gene [Source:MGI Symbol;Acc:MGI:2137630]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35234 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4459
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108852 Nonsense 95 554 2 8
ENSDART00000133568 Nonsense 95 240 2 4
ENSDART00000141909 Nonsense 95 554 2 8
Genomic Location (Zv9):
Chromosome 12 (position 15880987)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14963173
GRCz11 12 15001476
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACCTCTGTCACGCTCCCTTATAGAATCACCCCCTCCTCTCTCTGTGTA[T/A]GACCCATCTCAACAACAGTCCTTTTTCAGCCAGTGCTTTACCAACCTGGG
Long Flanking Sequence:
ATGTTGCTACAAATTTTACCTAATAATGTTGCAAACTTGGTGGCCATACTTAAATTATATTTAGTAGTTTTTTTTTAAATAACATGTATTGTGTTGTGTTTTAGGTTATAGGTTGATGTGGAGATTCTGCATGTGAAGTCCGCTTTTACAGTTTCTTAATTCGAAACAAGTTTGTTGATGCTCTAGTACTTCAGAAGGTTTGATTGTGCATTTCCTATGTCGACATCCCATCAAACACCTGTGGTTAGCAGCACCCCTCTCCCACTGCCTACCCACTTCTCTAATGCTCAGCATTCTATTACTGTTAAGAAAAGAAAACCTCCCTTTTCTAACTTATCAGATTCCTCTCAGTCTCCTTCCCCACCATTATATCATAGTTTACCACCTCGGCCTCCATCTAAAGGATGCTCCCCAGTAAGTCGAGTGTTTCCTCATCGCTCCATTCAGTGGACACCTCTGTCACGCTCCCTTATAGAATCACCCCCTCCTCTCTCTGTGTA[T/A]GACCCATCTCAACAACAGTCCTTTTTCAGCCAGTGCTTTACCAACCTGGGCCTGATTGGACGTGGTTCCTTTGGTGAGGTTTTTAAGGTGAGACATTCCTTATTGTCCATTATTCCTATTCATAATGTTTCAGGTGGATGTACAGGGCATTTGTGTGTAACATCAGTTACCATCTTTTGTAGGAAAATTGGTTTTAAAAAAGTTAATTTTTCTCTCAAGTTATATCTTAATATAATTTGTTAAAGTAAAAGTCTTGAATTAGTATACTCTGAAACTTATTTTTATGAAATGGATGCAGTTTTACAAAATAAAGAATACATTTATGGGATGCAATGTAACACTATTAAGCTTGGTTTAAAAAAATAATAATTACATTTAGTAAGCTATGACGTTGCTGCATAGACATCTACATTGCTGTTTCTGCTTTCCAAAAAAAAAAAAAAAAATCTTTGCAACATTACATATTGACTAAAGTTCAAAAAGTGAAACCATAATCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35234
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108852 Nonsense 195 554 3 8
ENSDART00000133568 Nonsense 195 240 3 4
ENSDART00000141909 Nonsense 195 554 3 8
Genomic Location (Zv9):
Chromosome 12 (position 15880254)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14962440
GRCz11 12 15000743
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCATCTCTACATACAGACTGAACTCTGCTGTACCAGTCTACTGCTATA[T/A]GCCGAGGAAACACCATGTCACACTGGTATGCAAAACACTACATAAGAACT
Long Flanking Sequence:
TAATTTGTTAAAGTAAAAGTCTTGAATTAGTATACTCTGAAACTTATTTTTATGAAATGGATGCAGTTTTACAAAATAAAGAATACATTTATGGGATGCAATGTAACACTATTAAGCTTGGTTTAAAAAAATAATAATTACATTTAGTAAGCTATGACGTTGCTGCATAGACATCTACATTGCTGTTTCTGCTTTCCAAAAAAAAAAAAAAAAATCTTTGCAACATTACATATTGACTAAAGTTCAAAAAGTGAAACCATAATCATAGGCTTCTTTCATGTCTATCAGGTGGTGAGTCTTACAGACAATTGTCAGTATGCTGTGAAGCGTTCTGTTCATCGTTTTCGTAGTGAGGTTGAACGAGCAAAAAGCATCACAGAGGCTTGGAATCATGAGGAACTTCACCCACATCCTTACATTCTGGGTTTTATTGCGGCTTGGGAGGAGGCCGGCCATCTCTACATACAGACTGAACTCTGCTGTACCAGTCTACTGCTATA[T/A]GCCGAGGAAACACCATGTCACACTGGTATGCAAAACACTACATAAGAACTGTTCATATACACTTATTATAAATATTAGCCCCTCTGTTTATTTTCCCCAATGTCTGTTTAATGGAGAGAAGATTTTTTTTCTTCACATTTCTAAACATGATAGTTTTAATAACTCCATTTCTATTTACTGATATATTTTATCTTTGCCATGATGACAGTAAATAATATTTTACTAGATATCAACTGGGCAGGTTAGGGTAATTAGGCAAGTTATTGTATAACGATGGTTCTGTAGACAATCGGGGCAAAAATTAGCTTAAAGGGGCTAATAATTTTGACATTAAAATGTTTTTAAAAAAAATAAAACTTCTTTTATTCCAGCCTAAATAAAACAAATAGGACCTTTTCCGGAAGAAAAAATAGTATCAGATATTCTGTAAAAAATTCATTGGTCTGTTAAACATCATATATGTTTAAAAAAAAGAAAAAAACATTTAAAGGGGAGCTAAT
Associated Phenotype:
Not determined