Busch Lab

ZMP

si:ch73-173m3.3

Ensembl ID:
ENSDARG00000074719
ZFIN ID:
ZDB-GENE-091118-91
Human Orthologue:
RAB38
Human Description:
RAB38, member RAS oncogene family [Source:HGNC Symbol;Acc:9776]
Mouse Orthologue:
Rab38
Mouse Description:
RAB38, member of RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1919683]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4954
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109719 Essential Splice Site 162 217 3 4
ENSDART00000132831 Essential Splice Site 158 213 2 3
Genomic Location (Zv9):
Chromosome 21 (position 29297509)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30516753
GRCz11 21 30553448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCTGCAAAGAGAATGGATTTGTGGGCTGGTTTGAGACCTCTGCAAAGG[T/A]GAGCYGGTTATTTTGTGACCTTGAGTATCATGTTGTTGTTTTTTTNGGAGA
Associated Phenotype:
Not determined