Busch Lab

ZMP

ARMC3

Ensembl ID:
ENSDARG00000074708
Description:
armadillo repeat containing 3 [Source:HGNC Symbol;Acc:30964]
Human Orthologue:
ARMC3
Human Description:
armadillo repeat containing 3 [Source:HGNC Symbol;Acc:30964]
Mouse Orthologue:
Armc3
Mouse Description:
armadillo repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:1918132]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44113 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18404 Essential Splice Site Available for shipment Available now
sa18333 Nonsense Available for shipment Available now
sa32483 Essential Splice Site Available for shipment Available now
sa45826 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44113
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Essential Splice Site 98 867 3 18
ENSDART00000111237 Essential Splice Site 98 867 3 18
Genomic Location (Zv9):
Chromosome 24 (position 17614124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16920600
GRCz11 24 17065019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTGCGCAGGAATGCTGTCATGGCTTTGGGCGTCATGGCTTCTAACAG[T/C]ACGTAGGGTTTAAAAATAGGCACAGTAAGTAAATCAAAAGATTTTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18404
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Essential Splice Site 98 867 3 18
ENSDART00000111237 Essential Splice Site 98 867 3 18
Genomic Location (Zv9):
Chromosome 24 (position 17614124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16920600
GRCz11 24 17065019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTGCGCAGGAATGCTGTCATGGCTTTGGGCGTCATGGCTTCTAACAG[T/A]ACGTAGGGTTTAAAAATAGGCACAGTAAGTAAATCAAAAGATTTTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18333
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Nonsense 145 867 5 18
Genomic Location (Zv9):
Chromosome 24 (position 17612031)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16918507
GRCz11 24 17062926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGCCACATTGTGTTTGGCATCATTGTCAGTGGACTTCTCCTACAAGATC[C/T]AGATATTTGAAAGCAATGGACTTGAACCTCTTATTCAGCTCTTGTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32483
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Essential Splice Site 179 867 5 18
Genomic Location (Zv9):
Chromosome 24 (position 17611926)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16918402
GRCz11 24 17062821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCAGATGTGAAGAAAAACTCAGTGGAGTGCATCTTTAATCTAGTGCAA[G/A]TAAGACAACAGATTAGTCAGAGTCAGTCAGAAAGTTTGCTGTGATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45826
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Nonsense 412 867 10 18
Genomic Location (Zv9):
Chromosome 24 (position 17605127)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16911603
GRCz11 24 17056022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGATGCAGAAGGAGACAGGCTGTTGGTGCGACAGCTGCAAGACAGCTG[C/A]ACTGGAGCAGCTGTGTATGCGGCAATGGCCTTGACAAACATGGCATCACA
Associated Phenotype:
Not determined