Busch Lab

ZMP

matk

Ensembl ID:
ENSDARG00000074670
ZFIN ID:
ZDB-GENE-070705-183
Description:
Novel protein similar to vertebrate megakaryocyte-associated tyrosine kinase (MATK) [Source:UniProtK
Human Orthologue:
MATK
Human Description:
megakaryocyte-associated tyrosine kinase [Source:HGNC Symbol;Acc:6906]
Mouse Orthologue:
Matk
Mouse Description:
megakaryocyte-associated tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:99259]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9981 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa895
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113521 Essential Splice Site 38 438 2 11
Genomic Location (Zv9):
Chromosome 22 (position 4687719)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4662133
GRCz11 22 5046508
KASP Assay ID:
554-0802.1 (used for ordering genotyping assays)
KASP Sequence:
TCGTTCTTGATGTGAAYKGACATTTTCGACTAAAGTAGCTTCTGTTTTCC[A/T]GAGAAAAGGAGAATACACTGCCAGACACAACACAACAGGGGAGGAAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9981
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113521 Nonsense 244 438 7 11
Genomic Location (Zv9):
Chromosome 22 (position 4682112)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4656526
GRCz11 22 5040901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAACTCTSTTTCTCCAGAAACCTCCATCATAAGAATCTGGTGCCGTTAT[T/G]AGGAGTTATTCTGCATAACGGGCTTCATATAGTCACRGAGTTAATGACGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1934
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113521 Nonsense 429 438 11 11
Genomic Location (Zv9):
Chromosome 22 (position 4677422)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4651836
GRCz11 22 5036211
KASP Assay ID:
554-1922.1 (used for ordering genotyping assays)
KASP Sequence:
GCTGGCAGACGGAGCCCAAGAAGAGGCCGTCGTTCCACAAACTGCGAGAG[C/T]GAYTGGARAAAGAGCTGAAACTGMACACATGAGGTTTACCCAACRCTCAG
Associated Phenotype:
Not determined