Busch Lab

ZMP

ZCCHC6

Ensembl ID:
ENSDARG00000074645
Description:
zinc finger, CCHC domain containing 6 [Source:HGNC Symbol;Acc:25817]
Human Orthologue:
ZCCHC6
Human Description:
zinc finger, CCHC domain containing 6 [Source:HGNC Symbol;Acc:25817]
Mouse Orthologue:
Zcchc6
Mouse Description:
zinc finger, CCHC domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2387179]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa26633 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25321 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26633
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109487 Essential Splice Site 302 877 8 27
Genomic Location (Zv9):
Chromosome 5 (position 72332340)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68693672
GRCz11 5 69465969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGGCGGGATCTAAAAGACTGGCCCAAAAAGAGGATTGCAATAGAAGG[T/G]ACTGATCACATCTTGGCTTGAGAAATCATGCTAAAAAACATGCCGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25321
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109487 Nonsense 808 877 25 27
Genomic Location (Zv9):
Chromosome 5 (position 72322341)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68683673
GRCz11 5 69455970
KASP Assay ID:
554-7859.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAACCGGGAGTCGGTGGGTGAGCTGTGGCTCGGCCTGCTGCAGTTTTA[C/G]ACTGAGACCTTCGACTTCAGGGAGTCTGTGATCTGTATCCGCAGAAAAGA
Associated Phenotype:
Not determined