Busch Lab

ZMP

si:dkey-210e6.2

Ensembl ID:
ENSDARG00000074638
ZFIN ID:
ZDB-GENE-081104-370
Description:
Novel protein similar to human and mouse lipoxygenase homology domains 1 (LOXHD1) [Source:UniProtKB/
Human Orthologue:
LOXHD1
Human Description:
lipoxygenase homology domains 1 [Source:HGNC Symbol;Acc:26521]
Mouse Orthologue:
Loxhd1
Mouse Description:
lipoxygenase homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1914609]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31624 Essential Splice Site Available for shipment Available now
sa41097 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31624
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109492 Essential Splice Site 402 597 9 12
ENSDART00000133456 None None 646 None 10
ENSDART00000140793 None None 1507 None 31
Genomic Location (Zv9):
Chromosome 8 (position 833693)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 700203
GRCz11 8 765946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAGAGAAGAAAGAAGACAAGAAGAAGAAGAAGAAGAGTAAGAAGAAGA[G/A]TGAGGATGATGATGAGGAGGAGGGTGGAGAGGAGATGCGGCAGGTGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41097
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109492 Nonsense 489 597 10 12
ENSDART00000133456 None None 646 None 10
ENSDART00000140793 Nonsense 999 1507 21 31
Genomic Location (Zv9):
Chromosome 8 (position 830492)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 697002
GRCz11 8 762745
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTCATCAACATCTACGGGGAAAACGGAGACACCGGCGAGCGGCGCCTC[A/T]GAAAGTCCAACCATATGAACAAGTTTGAGCGCGGACAGGTGAGCGGACAT
Associated Phenotype:
Not determined