Busch Lab

ZMP

si:dkey-201c1.1

Ensembl ID:
ENSDARG00000074626
ZFIN ID:
ZDB-GENE-081104-353
Human Orthologue:
LRDD
Human Description:
leucine-rich repeats and death domain containing [Source:HGNC Symbol;Acc:16491]
Mouse Orthologue:
Lrdd
Mouse Description:
leucine-rich and death domain containing Gene [Source:MGI Symbol;Acc:MGI:1889507]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1707 Essential Splice Site Available for shipment Available now
sa14411 Essential Splice Site Available for shipment Available now
sa44222 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4326
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105 Nonsense 84 752 1 17
ENSDART00000144907 Nonsense 274 942 2 15
Genomic Location (Zv9):
Chromosome 25 (position 4747570)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4401270
GRCz11 25 4527797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTGGAGGAGCTGGACGTGTCCTTTAACCTGCTGGAGAAACTTCCAGAT[G/T]AACTGGGCCAACTGCAGAACTTACAGCGGCTGGAGCTGTCAAATAACARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1707
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105 None None 752 None 17
ENSDART00000144907 Essential Splice Site 486 942 6 15
Genomic Location (Zv9):
Chromosome 25 (position 4743896)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4397596
GRCz11 25 4524123
KASP Assay ID:
554-1653.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAGGAAGTGACAAACACAGCTGCAGGCCTGGAGGACGTCCTGCACGGG[T/C]CAGCCAATCAGATCAATCACAGACAAACAACRTATTTCATATTGCTGCTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105 Essential Splice Site 346 752 6 17
ENSDART00000144907 Essential Splice Site 544 942 7 15
Genomic Location (Zv9):
Chromosome 25 (position 4742115)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4395815
GRCz11 25 4522342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGTTTCCCTCCAAACTGTACAGCGGAGACGCGCACCGTCACACTGCAG[G/A]TCTGTACAATAATACAGAATTCTGAATTACATGATTCAATATTTGTGCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30193
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105 Essential Splice Site 402 752 9 17
ENSDART00000144907 None 599 942 9 15
Genomic Location (Zv9):
Chromosome 25 (position 4739417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4393117
GRCz11 25 4519644
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATATATATATATATGTGTGTGTGTGTGTTCAGGACACATGTTGGACCT[G/C]TCCCGTCTGCACCTGATGCATGGCGACCCCACGGCCCACACCTGGACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44222
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105 Nonsense 431 752 9 17
ENSDART00000144907 Nonsense 629 942 9 15
Genomic Location (Zv9):
Chromosome 25 (position 4739327)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4393027
GRCz11 25 4519554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGGACAGACGTCACCGCTCAAGTGTCCCTGTACGTCACACACATCTA[C/A]GCCGTCTTCTTCATCACACACTTCTCATGGTGAGCAACTGCAAACACACA
Associated Phenotype:
Not determined