Busch Lab

ZMP

si:dkey-127k13.2

Ensembl ID:
ENSDARG00000074604
ZFIN ID:
ZDB-GENE-070912-369
Description:
Novel protein similar to vertebrate polyhomeotic homolog 3 (Drosophila) (PHC3) [Source:UniProtKB/TrE
Human Orthologue:
PHC3
Human Description:
polyhomeotic homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:15682]
Mouse Orthologue:
Phc3
Mouse Description:
polyhomeotic-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2181434]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32966 Nonsense Mutation detected in F1 DNA Not yet available
sa19818 Nonsense Available for shipment Available now
sa32967 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6015 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32966
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Nonsense 79 893 2 16
ENSDART00000132427 Nonsense 85 96 3 3
ENSDART00000140558 None None 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37149671)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37446381
GRCz11 2 37428838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATGCAGCTCAACAACAACACATCCTGCTGCAGACAGCAGCGCTACAA[C/T]AGCAACAGCAACATCAACAAAACCTCACCGCTGCACAGATTCTGACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19818
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Nonsense 81 893 2 16
ENSDART00000132427 Nonsense 87 96 3 3
ENSDART00000140558 None None 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37149677)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37446387
GRCz11 2 37428844
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTCAACAACAACACATCCTGCTGCAGACAGCAGCGCTACAACAGCAA[C/T]AGCAACATCAACAAAACCTCACCGCTGCACAGATTCTGACAACTACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32967
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Essential Splice Site 288 893 None 16
ENSDART00000132427 None None 96 None 3
ENSDART00000140558 None 174 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37157773)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37454483
GRCz11 2 37436940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAACAACGTGACTCAGACACCATCCGCCCAACCAGCCATTCCTCCTTG[T/A]AAGTCACAAAATATATATTTTTTAAATCTATTTAATGGGTTTAATGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6015
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Nonsense 892 893 16 16
ENSDART00000132427 None None 96 None 3
ENSDART00000140558 None None 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37168601)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37465311
GRCz11 2 37447768
KASP Assay ID:
554-3686.1 (used for ordering genotyping assays)
KASP Sequence:
TCAAACTGGGACCTGCACTCAAGATCTGTGCGCACATAAATACTCTCAAA[C/T]AAACTTAAGACCGTCACATCCTCCTAAAGTGCCATGATTCCAGTGCATGG
Associated Phenotype:
Not determined