Busch Lab

ZMP

rin2

Ensembl ID:
ENSDARG00000074589
ZFIN ID:
ZDB-GENE-090312-194
Human Orthologue:
RIN2
Human Description:
Ras and Rab interactor 2 [Source:HGNC Symbol;Acc:18750]
Mouse Orthologue:
Rin2
Mouse Description:
Ras and Rab interactor 2 Gene [Source:MGI Symbol;Acc:MGI:1921280]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42211 Nonsense Mutation detected in F1 DNA Not yet available
sa35498 Nonsense Mutation detected in F1 DNA Not yet available
sa38945 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42211
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110494 Nonsense 174 938 5 12
ENSDART00000131128 Nonsense 174 938 5 11
ENSDART00000138043 Nonsense 174 938 6 12

The following transcripts of ENSDARG00000074589 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27492893)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27138553
GRCz11 13 27269003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTCAGGAATCAGCTTTGCAGACCTCTTTCGTCTGGTGGCGTTCTGCTG[T/A]ATCAGCAGGTAAGTTGATCTCGCTCTTAAAATGACAAAAACTCCTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110494 Nonsense 603 938 7 12
ENSDART00000131128 Nonsense 603 938 7 11
ENSDART00000138043 Nonsense 603 938 8 12

The following transcripts of ENSDARG00000074589 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27502040)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27147700
GRCz11 13 27278150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACCGGGGATGCCACACATCAGGCTTGGAACTGCTTCAGACACTCAGA[C/T]AGTTCATGACCCAGATGAAGTCCTACTTGTTGCAGAGCTCAGAGCTTGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28119
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110494 Nonsense 630 938 7 12
ENSDART00000131128 Nonsense 630 938 7 11
ENSDART00000138043 Nonsense 630 938 8 12

The following transcripts of ENSDARG00000074589 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27502121)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27147781
GRCz11 13 27278231
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGCTCAGAGCTTGACCCACCCATTGAGTCGCTTATCCCGGAGGAT[C/T]AAATCGGTAAGGCTTCCTTCCTTCAATACTAAACGTTTCATGCAAGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38945
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110494 Essential Splice Site 833 938 10 12
ENSDART00000131128 Essential Splice Site 833 938 10 11
ENSDART00000138043 Essential Splice Site 833 938 11 12

The following transcripts of ENSDARG00000074589 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27514900)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27160560
GRCz11 13 27291010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGCAGACGCACAACTCAGAGAACCACACCATCTGTGGATGATTTCCAGG[T/C]TAATCTCTCATTTATACATACACATTTATGTTCTAAAATAATATGGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22312
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110494 Nonsense 910 938 11 12
ENSDART00000131128 Nonsense 910 938 11 11
ENSDART00000138043 Nonsense 910 938 12 12

The following transcripts of ENSDARG00000074589 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27517595)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27163255
GRCz11 13 27293705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTCGACACGCACCCGCAGAAGATCAAGGCTGAACTGCACAGCCGGCCG[C/T]AGCCACAGATCTTCTACTTCGTTTACCGGCAGATCCAAAACTTCCCCGTC
Associated Phenotype:
Not determined