Busch Lab

ZMP

ENSDARG00000074585

Ensembl ID:
ENSDARG00000074585
Human Orthologue:
PACS1
Human Description:
phosphofurin acidic cluster sorting protein 1 [Source:HGNC Symbol;Acc:30032]
Mouse Orthologue:
Pacs1
Mouse Description:
phosphofurin acidic cluster sorting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277113]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10795 Essential Splice Site Available for shipment Available now
sa17470 Nonsense Available for shipment Available now
sa42315 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10795
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Essential Splice Site 68 883 4 31
Genomic Location (Zv9):
Chromosome 13 (position 53953332)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51627919
GRCz11 13 51868966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACGTAWATGCATGTGTGTGTGTATCTGGTTTAATGTGTSGSTTTGTGTG[T/A]GCAGGGCTCCAAACGAGTGCTGCGGTCAAAYGAGTATGCTCTTCCTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17470
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Nonsense 616 883 23 31
Genomic Location (Zv9):
Chromosome 13 (position 53966327)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51640914
GRCz11 13 51881354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTCATTMGACAGTAAGTTCAGCAGCATGTTCATGGAGCCATCGTGGAGG[G/T]AGCTGTTCTGCCGGCCAGAACCCCCGAACACAGGTACAGCTAATGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Essential Splice Site 626 883 23 31
Genomic Location (Zv9):
Chromosome 13 (position 53966361)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51640948
GRCz11 13 51881388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCCATCGTGGAGGGAGCTGTTCTGCCGGCCAGAACCCCCGAACACAG[G/A]TACAGCTAATGAGTGTGATGCTGATAAACAGAGGTTTTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28215
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Essential Splice Site 880 883 30 31
Genomic Location (Zv9):
Chromosome 13 (position 53976699)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51651286
GRCz11 13 51891793
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCCACACACGTCAAACACTTCCCCGTGGGTGTGTTCGGCTACAGCAAA[C/T]CTGTGTGACTGTGTGTGTGTGCACTGACCAGAGGCGCTCGGTCAACAGGT
Associated Phenotype:
Not determined