Busch Lab

ZMP

add2

Ensembl ID:
ENSDARG00000074581
ZFIN ID:
ZDB-GENE-080718-4
Description:
Novel protein similar to vertebrate adducin 2 (Beta) (ADD2) [Source:UniProtKB/TrEMBL;Acc:A2BFZ3]
Human Orthologue:
ADD2
Human Description:
adducin 2 (beta) [Source:HGNC Symbol;Acc:244]
Mouse Orthologue:
Add2
Mouse Description:
adducin 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:87919]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31418 Nonsense Available for shipment Available now
sa20359 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa13879 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31418
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114841 Nonsense 206 670 5 14
ENSDART00000148297 Nonsense 153 462 4 10
Genomic Location (Zv9):
Chromosome 5 (position 15009712)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13301943
GRCz11 5 13802160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTTCCGCTGTCCCATGAGGCTTTGTTGGTGGGTGAAGTGGCTTATTA[T/A]GACTATAATGGAGTGATGGAGGAAGAAGAGGATCGAGTGGAGCTCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20359
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114841 Missense 264 670 6 14
ENSDART00000148297 Essential Splice Site 210 462 None 10
Genomic Location (Zv9):
Chromosome 5 (position 15009443)
KASP Assay ID:
2259-5528.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGCCTTTTACACAATCTACCACATCCAGACCGCCTGTCAAATACAGG[T/C]AGGCAAAAAAAAAATGAAATTGAAAAGCTTCTCATTTGGACAAAATGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13879
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114841 Essential Splice Site 583 670 14 14
ENSDART00000148297 None None 462 None 10
Genomic Location (Zv9):
Chromosome 5 (position 14991992)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13285850
GRCz11 5 13786067
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCTTTTACTATTTCTTTTGCATTTTTATTTCAATTGCATTCGCATAC[A/T]GATGAAAAAACTRCAGAKGCTGTTCAAAAYGATAAAGGYGATGAGAAGAA
Associated Phenotype:
Not determined