Busch Lab

ZMP

gab2

Ensembl ID:
ENSDARG00000074577
Human Orthologues:
GAB2, GAB4
Human Descriptions:
GRB2-associated binding protein 2 [Source:HGNC Symbol;Acc:14458]
GRB2-associated binding protein family, member 4 [Source:HGNC Symbol;Acc:18325]
Mouse Orthologue:
Gab2
Mouse Description:
growth factor receptor bound protein 2-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333854]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10243 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28445
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113515 Nonsense 30 666 2 10
Genomic Location (Zv9):
Chromosome 15 (position 21744403)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9543507
GRCz11 15 9519578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCAATCATAATTGTTTTTATTTCTCCCCAGGCATGGAAGAAGCGATG[G/A]TTTATCCTGCGCAGCGGCCGCATGAGCGGAGACCCGGATGTGTTGGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10243
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113515 Essential Splice Site 620 666 10 10
Genomic Location (Zv9):
Chromosome 15 (position 21817919)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9469991
GRCz11 15 9446062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAGTCAGAATTGTATTTGCGAAATCTATACCCTTTATTTTCTCTCTTAC[A/T]GCCGTCCACCTCTTCAGTCACCTCAGATGAAAAAGTGGACTATGTGCAAG
Associated Phenotype:
Not determined