Busch Lab

ZMP

B3DIN8_DANRE

Ensembl ID:
ENSDARG00000074570
Description:
LOC566865 protein [Source:UniProtKB/TrEMBL;Acc:B3DIN8]
Human Orthologues:
RP4-539M6.17, RP4-539M6.19, SEC14L2, SEC14L3, SEC14L4
Human Descriptions:
SEC14-like [Source:RefSeq peptide;Acc:NP_001180265]
SEC14-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:10699]
SEC14-like 3 (S. cerevisiae) [Source:HGNC Symbol;Acc:18655]
SEC14-like 4 (S. cerevisiae) [Source:HGNC Symbol;Acc:20627]
Mouse Orthologues:
Sec14l2, Sec14l3, Sec14l4
Mouse Descriptions:
SEC14-like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915065]
SEC14-like 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:3617848]
SEC14-like 4 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2144095]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3794
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115359 Nonsense 7 387 1 13
ENSDART00000125576 None None 378 None 14
Genomic Location (Zv9):
Chromosome 11 (position 21347008)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45078652
GRCz11 10 44925264
KASP Assay ID:
2260-4191.1 (used for ordering genotyping assays)
KASP Sequence:
GCATTTRGTATCCAATAAATGCATATTGTGTTGGCCAAAACWCTGAAATA[T/A]CCTCTCTTTGGTCAGTTTCGGGAGAAATTAGAAGATGTTTGGGATCAACT
Long Flanking Sequence:
GGCTTTAACACAGGCAAGTACATGCAGAATTTTGCTTACATTTATTAAATAACTTACACTACCTTTCAAAATTTGAGGTGATTTATTATTATTTTTTATTTAAAGAAATTAATACGTTCTTAAATTCAGTAAAGATGCACTGAATTTATCAAAAATTATATTTATAACTGTACAAACGCTTTTATTTCAAATAAACGCTTTACTTATGAACTTCCTAATCATCTATGAATCTTAAAACAATTAATATATCATAATAATCATAGCAAAATATTCATAAATGTCTCTTAATTTATATATAATCATATTAGAGTGATTTCTGAAAGATCGGGTGACACTGAAGACTAATATAATGATTCTTATATCACAGAAGTTAATTACACTTCATCTATTTACATAGAAATTGGTCACCCTGAATTAAAATGTTTTTCTTAATTAAAGCATTTTTTTACTGCATTTGGTATCCAATAAATGCATATTGTGTTGGCCAAAACACTGAAATA[T/A]CCTCTCTTTGGTCAGTTTCGGGAGAAATTAGAAGATGTTTGGGATCAACTGTCCAATCAAACTGATCATTACCTGCTCCGGTGGCTCAGAGGTGAGAATTTTGCTGCACAAATATAAACTTTTCTGCTGTTTTTAGTAAAAAGTGTTTAATAATGTAGTGTAGATCTCTGACTGATGAACTTTTGACCCCATGAACCTGATTAACAGGCTGACAATACAAAAAGAAAGCAATTTTGAGTTTTTCCTCATATTTCTATGGTTTTTCTGCAGCATTGGCTTTATCTAAACCACGTTTATCTAGAAATCAATGCGGTGTGTTGAGACAGAACATCCCAAAACCATGTGTTGACTTTACTTTTAGAAAAGGAAAGTTCAAGGTGACTTTCTTGTGAATGTATGCGTCAATATTTATCTGTTTTTAACCTTTGCAGAAATATTTGCTCTCTCCCTTTGCACTACATTATTATATAAGATCCCAAAGTCCTTGTGTGCATGAAGAG
Associated Phenotype:
Not determined