Busch Lab

ZMP

CNTNAP1

Ensembl ID:
ENSDARG00000074524
Description:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
Human Orthologue:
CNTNAP1
Human Description:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
Mouse Orthologue:
Cntnap1
Mouse Description:
contactin associated protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1858201]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12772 Nonsense Available for shipment Available now
sa26120 Nonsense Mutation detected in F1 DNA Not yet available
sa31346 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa12772
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 180 1292 4 23
Genomic Location (Zv9):
Chromosome 3 (position 36924443)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36787803
GRCz11 3 36929661
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGCATACTCGTTCCCGCGGGGCAGAATGARGACACTCCAGGACCACTA[T/A]GCTCTGAAYTTTAAGACACTGGAGAAGGACGGTATTTTACTGCACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26120
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 283 1292 6 23
Genomic Location (Zv9):
Chromosome 3 (position 36922657)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36786017
GRCz11 3 36927875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTAAGTCATTACTTAAATGTTCCCCAAATTATTTTTCTTTAGATTTA[T/A]GTTGGTGGTGTGATTGAGAAAGACATGCCACACCTGCCCGGTAAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31346
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Missense 522 1292 9 23
Genomic Location (Zv9):
Chromosome 3 (position 36918648)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36782008
GRCz11 3 36923866
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGCTGCAGAGGAAATGGGGCAGATATGCAGAAATCCTGCTGGGCACC[T/A]GCGGGATCACTGATAGGTAAGTGTGTGTTTGGGTGTGTGGGTTTTGCCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3434
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 583 1292 11 23
Genomic Location (Zv9):
Chromosome 3 (position 36918179)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36781539
GRCz11 3 36923397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTCATGTGAGGCCTACAGACTCAATGGAAAATAYTGGTCAGGCAACTA[C/A]ACCATAGACCCAGATCTGAGCGGACCACTGAAGCCTTTYACCGTCTACTG
Associated Phenotype:
Not determined