Busch Lab

ZMP

GRIK2 (1 of 2)

Ensembl ID:
ENSDARG00000074515
Description:
glutamate receptor, ionotropic, kainate 2 [Source:HGNC Symbol;Acc:4580]
Human Orthologue:
GRIK2
Human Description:
glutamate receptor, ionotropic, kainate 2 [Source:HGNC Symbol;Acc:4580]
Mouse Orthologue:
Grik2
Mouse Description:
glutamate receptor, ionotropic, kainate 2 (beta 2) Gene [Source:MGI Symbol;Acc:MGI:95815]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42644 Nonsense Mutation detected in F1 DNA Not yet available
sa36014 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42644
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109264 Nonsense 82 871 2 17
Genomic Location (Zv9):
Chromosome 16 (position 2691922)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1850819
GRCz11 16 1887168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGGCTGCCATCTTCGGGCCCTCGCACAGCTCCTCTGCCAACGCGGTG[C/T]AGTCCATCTGTAACGCTCTCGGGGTGCCACACATACAGACCAAGTGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36014
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109264 Nonsense 562 871 13 17
Genomic Location (Zv9):
Chromosome 16 (position 2841931)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2000828
GRCz11 16 2033881
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTTTAGCCCCTACGAATGGTATAACCCTCACCCGTGCAACCCCGACT[C/A]GGACGTGGTGGAAAACAATTTCACCCTGCTAAATAGTTTCTGGTTCGGAG
Associated Phenotype:
Not determined