Busch Lab

ZMP

si:ch73-215d9.1

Ensembl ID:
ENSDARG00000074486
ZFIN ID:
ZDB-GENE-100922-40
Human Orthologue:
KIAA0319
Human Description:
KIAA0319 [Source:HGNC Symbol;Acc:21580]
Mouse Orthologue:
D130043K22Rik
Mouse Description:
RIKEN cDNA D130043K22 gene Gene [Source:MGI Symbol;Acc:MGI:3036268]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa30691 Nonsense Mutation detected in F1 DNA Not yet available
sa18427 Essential Splice Site Available for shipment Available now
sa14911 Nonsense Available for shipment Available now
sa16403 Nonsense Available for shipment Available now
sa42778 Nonsense Mutation detected in F1 DNA Not yet available
sa31007 Nonsense Mutation detected in F1 DNA Not yet available
sa42779 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30691
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 194 1061 1 25
ENSDART00000143692 Nonsense 7 773 1 18
Genomic Location (Zv9):
Chromosome 16 (position 38322369)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36954897
GRCz11 16 36908781
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCGGTAGAGCAAGAAGAGCAAACTGGGCTTTATGATTGGCCACCTGTT[C/T]AAAGAAAAGAGGAATTCAACCAATCAGAGACGGAGAGAGGCAGTAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18427
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Essential Splice Site 306 1061 None 25
ENSDART00000143692 Essential Splice Site 123 773 None 18
Genomic Location (Zv9):
Chromosome 16 (position 38324926)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36957454
GRCz11 16 36911338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCCAGCCAACACTGAAGCTACACCGCAGATGACTTCAGAACAGCCAGG[T/G]ACTGTGCGCAATATTGGGGAAAGTTACTTTAAAAGCAAAAATGCTGTACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6441
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Essential Splice Site 340 1061 7 25
ENSDART00000143692 None None 773 None 18
Genomic Location (Zv9):
Chromosome 16 (position 38326921)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36959449
GRCz11 16 36913333
KASP Assay ID:
554-4513.1 (used for ordering genotyping assays)
KASP Sequence:
ATACATGCTGTGTCTTGTGTGAACACAGCGACAGAAACCTATTTGTCATC[T/C]AAAATATTGACGTCCATAGTAGGAAAAACAAAGACGATTGTTACAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 501 1061 13 25
ENSDART00000143692 Nonsense 278 773 7 18
Genomic Location (Zv9):
Chromosome 16 (position 38328749)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36961277
GRCz11 16 36915161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGGAAAAAGGTGGACGGCCCGTTTTGGACACCTGAAGGTCCTGTTAAY[A/T]AAMCTGTACTGCAGCTGAAAAATCTTTTAYCTGGAGAATATACCTTCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16403
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 542 1061 14 25
ENSDART00000143692 Nonsense 319 773 8 18
Genomic Location (Zv9):
Chromosome 16 (position 38331072)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36963600
GRCz11 16 36917484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTGAGCGACTCCAGCACTGCCACCTTGAGGGTCAGCATCCCAAAAGAT[G/T]AGCCTCCTCTGGCCAGAGCGGGCACAGACCGGGTCATTACCCTGCCTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3952
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 619 1061 15 25
ENSDART00000143692 Nonsense 396 773 9 18
Genomic Location (Zv9):
Chromosome 16 (position 38332618)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36965146
GRCz11 16 36919030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTGATCTAGAGGAGGGTCAGTACACGTTTCAGCTCACAGTCACTGACT[C/A]AAGAGGTCAACAGGATTCAGACACCATCTCYGTCACTGTGCTGCCTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42778
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
Genomic Location (Zv9):
Chromosome 16 (position 38339149)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36971677
GRCz11 16 36925561
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAACAGAGAGACACAGTGATCAGACAGCTGGCCGCACTTCTGCATGTGT[T/A]GGACTCAGACATCGCACTAAAGGCTCTACATGGACAGTCTGACATCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31007
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
Genomic Location (Zv9):
Chromosome 16 (position 38339149)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36971677
GRCz11 16 36925561
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAACAGAGAGACACAGTGATCAGACAGCTGGCCGCACTTCTGCATGTGT[T/A]GGACTCAGACATCGCACTAAAGGCTCTACATGGACAGTCTGACATCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42779
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 907 1061 21 25
ENSDART00000143692 Nonsense 683 773 15 18
Genomic Location (Zv9):
Chromosome 16 (position 38340089)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36972617
GRCz11 16 36926501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTTGATCCCTGGCCCTAAACTTGCCCGCCTGCTGAGAAACCAGCTGT[T/A]GAGAGAGAAAAGCGACTTCTTGCTCTTTAGGGTCTTAAGAGTGGACACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7800
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Essential Splice Site 925 1061 21 25
ENSDART00000143692 Essential Splice Site 701 773 15 18
Genomic Location (Zv9):
Chromosome 16 (position 38340144)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36972672
GRCz11 16 36926556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAAAAGCGACTTCTTGCTCTTTAGGGTCTTAAGAGTGGACACAGTCAG[T/A]RAGTGACTTGAATCCTWTAMTAAATAATTTCAYTAATGTTTTACAACAAA
Associated Phenotype:
Not determined