Busch Lab

ZMP

cnksr2

Ensembl ID:
ENSDARG00000074480
ZFIN ID:
ZDB-GENE-060228-5
Human Orthologue:
CNKSR2
Human Description:
connector enhancer of kinase suppressor of Ras 2 [Source:HGNC Symbol;Acc:19701]
Mouse Orthologue:
Cnksr2
Mouse Description:
connector enhancer of kinase suppressor of Ras 2 Gene [Source:MGI Symbol;Acc:MGI:2661175]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa37902 Nonsense Mutation detected in F1 DNA Not yet available
sa37903 Nonsense Mutation detected in F1 DNA Not yet available
sa6772 Nonsense Mutation detected in F1 DNA Not yet available
sa45832 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30107
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 Essential Splice Site 429 1025 11 21
ENSDART00000142351 Essential Splice Site 442 684 11 15
Genomic Location (Zv9):
Chromosome 24 (position 26093368)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25420426
GRCz11 24 25565377
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAGCCATGGACCCACAACATCCCGTCGGGACAGCACCCCCACTTATGG[T/A]ACACAAGCACACACACACACACACACAGAGAGAGAGAGAAACAAAAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 Nonsense 442 1025 12 21
ENSDART00000142351 Nonsense 455 684 12 15
Genomic Location (Zv9):
Chromosome 24 (position 26094279)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25419515
GRCz11 24 25564466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCTTTTAGGTCGTCTGAGGCCCATCTCAATGCCTGTGGAGTATAACT[G/A]GGTTCCTGACTATGAAGACCCAGCTAGAGTGAAGAGAGACGGTCGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37903
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 Nonsense 694 1025 18 21
ENSDART00000142351 None None 684 None 15
Genomic Location (Zv9):
Chromosome 24 (position 26126857)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25386937
GRCz11 24 25531888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGGAGTGAAAGTGATCATGAAGACAATGAGACGCCCTCGACGCCCAAG[C/T]AAGACAGCCCACCACCCCCTTATGACACATACCCACGGCCACCCTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6772
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 Nonsense 933 1025 20 21
ENSDART00000142351 Nonsense 590 684 14 15
Genomic Location (Zv9):
Chromosome 24 (position 26144047)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25369747
GRCz11 24 25514698
KASP Assay ID:
554-5163.1 (used for ordering genotyping assays)
KASP Sequence:
CCACTCGTCTGGAGTACAAACWTCTTTTCATCCGGCGTTGCAACGATCCA[C/T]AGCTAAATGACAAACTGCATCACCTTCGCATCCTGCAGAGCAYGCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45832
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 None None 1025 None 21
ENSDART00000142351 Essential Splice Site 609 684 14 15
Genomic Location (Zv9):
Chromosome 24 (position 26144107)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25369687
GRCz11 24 25514638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAACTGCATCACCTTCGCATCCTGCAGAGCACGCTAAAGGTATCCGAA[C/T]TCTGCTGCCGCATGGGTCCCACTGCACCCTGTGTGCCTGTTTGTTTCATC
Associated Phenotype:
Not determined