Busch Lab

ZMP

gdpd3

Ensembl ID:
ENSDARG00000074466
ZFIN ID:
ZDB-GENE-040426-2279
Description:
glycerophosphodiester phosphodiesterase domain containing 1 like [Source:RefSeq peptide;Acc:NP_9983
Human Orthologue:
GDPD3
Human Description:
glycerophosphodiester phosphodiesterase domain containing 3 [Source:HGNC Symbol;Acc:28638]
Mouse Orthologue:
Gdpd3
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915866]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16999 Nonsense Available for shipment Available now
sa20018 Essential Splice Site Available for shipment Available now
sa10838 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16999
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103748 Nonsense 53 315 3 11
Genomic Location (Zv9):
Chromosome 3 (position 26835146)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26069090
GRCz11 3 26199961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTTTGTCTRACCTCCTGCTCTCTGTCCTCAGGTTCTGGTGAAAGGATC[G/T]AGAACACTATAGAGGCCTTCACACAGTRAGTGATCAGTTATACTGGGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20018
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103748 Essential Splice Site 191 315 7 11
ENSDART00000103748 Essential Splice Site 191 315 7 11
Genomic Location (Zv9):
Chromosome 3 (position 26837816)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26066420
GRCz11 3 26197291
KASP Assay ID:
2259-3488.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTGGGCCTCTGTTGACTCTACCATCATGGAAAACTGTCGCAAAATAG[T/A]GCGTGTGCACTTGTATCCCTCTCTGCAAGCTTTGTTTCAGTAATAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10838
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103748 Essential Splice Site 191 315 7 11
ENSDART00000103748 Essential Splice Site 191 315 7 11
Genomic Location (Zv9):
Chromosome 3 (position 26837816)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26066420
GRCz11 3 26197291
KASP Assay ID:
2259-3488.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTTGGGCCTCTGTTGACTCWASCATCATGGAAAACTGTCGCAAAATAG[T/C]GCGTGTGCACTTGTATCCCTCTCTGCAAGCTTTGTTTYAGTAATAAATAG
Associated Phenotype:
Not determined