Busch Lab

ZMP

IBTK

Ensembl ID:
ENSDARG00000074424
Description:
inhibitor of Bruton agammaglobulinemia tyrosine kinase [Source:HGNC Symbol;Acc:17853]
Human Orthologue:
IBTK
Human Description:
inhibitor of Bruton agammaglobulinemia tyrosine kinase [Source:HGNC Symbol;Acc:17853]
Mouse Orthologue:
Ibtk
Mouse Description:
inhibitor of Bruton agammaglobulinemia tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:1918677]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa7239 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15648 Essential Splice Site Available for shipment Available now
sa15518 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1648
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Nonsense 740 1349 14 33
Genomic Location (Zv9):
Chromosome 16 (position 5816642)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5042585
GRCz11 16 4872298
KASP Assay ID:
554-1588.1 (used for ordering genotyping assays)
KASP Sequence:
ATGTAGGCTGGACGGTGTGAAGTTTGAGAATGGGAAGATCAGTGTGGGGT[T/A]ACAGAAGAAAAGGGGCAACAAGCCTCGATTCACCCTGAAGAAGGGGTAGG
Long Flanking Sequence:
AAAAAGGGAAGCACTATGAATACTTTCCGGATGCACTGTACATGCATGCCTGTGTGAATTTATACATTCATAATCAATACACACAGTACACACACTTAAGTTATGTCTAAACAAAATTGTTTTTGCCGAGCACTAATATTTTCATCAATTTTTCCTATAAAGTTAACCCTTAGTTTGCATCTTACATCCTAACCCATTCTGCATTTGAGCAACTTTTCATTAATGAATAGTTATCAGGTTATTAAGGCAGCATATGAGGTATTTATTCCATGTTGTCATAACAAAGACATGTGCATTTAAAATGACATAACTGAGCATATAACACTTAATGACCATTGCTATAAGCATGCATAAAATCTCTCACCAAAATATTTGACTCTCATGATACTGTTACAATTATGTAATAAGGGCTTTATTATTGAGGGTGTTGTAATTGAATGTTTTCTCCATATGTAGGCTGGACGGTGTGAAGTTTGAGAATGGGAAGATCAGTGTGGGGT[T/A]ACAGAAGAAAAGGGGCAACAAGCCTCGATTCACCCTGAAGAAGGGGTAGGTTTTTCCTCTTCTCATCTGAGCTCATGTTCCTGTTTCGGTGTGTGTAAATGCTGATGTTTTCATTCTGTGATTACAGCTCACATCTCTGCGACGTTACTCTGCGCTCTGTGGACGGAAAAGAGTTCTCCTGCCACAAGTGTATCCTCTGCGCTCGACTGGGTGAGCTCTTAAATGCTGCATTTAAACTTATTCATATTTAATCTAACTTTTATTGACATTTAATATGAAATGGTTCCCTCTTTTTCTGCAGAGTATTTCAACAGTATGCTGGGCAGCTCCTGGATGGAGGTATGATGAAACGCCATTAAAATGACTCGTCTTTTACTTGCCACAAACCTGTTTGAGTTTCTTTTTTTTGCTCAAACTACAAGATGTTCTGAATAGCGATGCTCATTTCGGTTAATTTTGCTAACCGACAATTAATCGGTTATTAACGGTTAACTGGTCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28574
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Essential Splice Site 1138 1349 26 33
Genomic Location (Zv9):
Chromosome 16 (position 5830012)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5055934
GRCz11 16 4885647
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGGAAATCTTCTCATATTGTGTTATTATGACACGTGTTAGTCATGATA[G/A]TTTACACGAAATCATTTGAAACATGCTAGCAACATGCTAATTCTTGCCAG
Long Flanking Sequence:
CCCTGTATTAAACAAACTTGAACTCTATGTATTCATGTTGGCAGGATGAGAGACGTGGACCGGCAGGACTGAAGACTCCTCCGGGAACCCCTGTTTTGAAGAACGGCCCTGTGCCTGTCCAGTCTTCCACTCCTGAACACATCCCTACGGTCAAAGCCAGGTGACTGAACTTCTCTCTCACAGCAAGAAGCAGAGACTCCCTCTCTGTTTCGCTGTTATTCTGAATGTTTCTGTGTCTCCAGACCAGCTCCTGTCCTGGACCTCAGGGCCATCATGGAGATGGAGGCGAACTCTCTGAATCTGGGCGCCACTCCTAAAGCCATCAGCGGGTTAGTGGGGAATAGTTGATGAGGGGGCTATGAGTTATTCGTAAATATTGCATGAACATCAGAGCTGTGACTGCAAACCCAAATCTGTCATGTGTCTGGTTCAGACAGCTAAACTGCTTATTGCGGAAATCTTCTCATATTGTGTTATTATGACACGTGTTAGTCATGATA[G/A]TTTACACGAAATCATTTGAAACATGCTAGCAACATGCTAATTCTTGCCAGAAACATTCTAGCAACATGTTAATTCTTGCTAGAAACATGCTAACAGCATGCTAGTTCAAACTGGAAACATGCTAACAACAAGCTAACTCATGTTGGAATCATGCTAACAATGTGCTTATGAAGATCTATTTAATTGTCTTTTCGGCTTGGTCTCTTTATTGATCAGGGATTGCCACAGCGAAATAAACCGCCAACTTATCCAGCACGTTTTATGCAGCGAATACCCTTCCAGCTACAACCCATCACTGGAAAAGGATGTTTATTCAAATTAGAAACTGCTAACAACATGCTAATTCATGTTGAAATCATGCTAACAACATGCTAATGAGGTCTAATGAAGTGAAATTAAACAGTATTTACAATATTATTAGCTTTAAACCACAAACTGTTTAAATACTGGAGAAACATGCTAACACCATGCTAATTCATGCCAGAACATCCTAGCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7239
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Essential Splice Site 1251 1349 30 33
Genomic Location (Zv9):
Chromosome 16 (position 5837254)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5063178
GRCz11 16 4892336
KASP Assay ID:
554-4616.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAAATKATCTTACTGATCATGCTACCCACTGTGCCACCGTGACACCTA[T/A]CCAAGGCTCAAAAANNNNNNNNNNNNNNNNNNNNACCTCATTCTTCAGTGCTGAAGTGCGCTCGCTTTTG
Long Flanking Sequence:
GACAATTTAGCATATTCAATTCACCTATAGCGCATATGTTTGGACTAAAGGGGAAACCGGAGCACCTGAAGGAAACCCACGCCAACACGAGGAGAATATGCAAACTCTAAACTAGAGCTCACCAAACTTGTTCCTGGAGGGCCTGCAGACGTTAGCTCCAACCCTAATCAAACACACCTGAACATTCTAATCAAGGTCTTACTAGGTGTACTTGAAACATCCAGGCAGGTGTGTTGAGGCAAGTTAGAGCTAAACCCTGCATAGACACCGGCCCTCCAGGATCGAGATTGCTGACCCCTGCTCTAAACAGAAATGCCAACTGACCCACCGGAACCAGTCACCTTCTTAGGCAAGACAAGGCAAGTTTATTTATATAGCACATTTCATACACAATGGCAATTCAAAGTGCTTTACATAAACAAGAATAAAAGAAACAAGTAAAATTAAAATAAAAAATGATCTTACTGATCATGCTACCCACTGTGCCACCGTGACACCTA[T/A]CCAAGGCTCAAAAAACCTCATTCTTCAGTGCTGAAGTGCGCTCGCTTTTGCGATTTAGCTGTAGAACTTCTGATTCAGTTGCCGACTGGAGAAATGACCCGGGAAAATAAACAACAGAAAACGGTCTAGCTACTTGCTCTACAAACAAGTGTGTTTATGACTATACGTACACATAGAATAATATAATAAGAAAATATCCATTGCAGCTTAACAAGCTGACAAAAAATACAGAATAATAAAACTGACCCAACTTCAACATCAACTTTCATTTTCTTTTCTTTTAATTCTGCCAGTATTAACCCCACTAGCGCTACTAAATCAGCATCTGTAGGTCATTCATGACAGCTGTGCTCGTGTTGTCTTAACTTGCTTGAGCTGGTTTGATCATTGTTTATTTACTCAAAGCCAGTGTCAGGAGCAGTTTGTCTGATTCAGGGTGTGATGTTGAGTGTGTGCGCGAGTGTTTTCTGTCGGCTCTGTTCTGTAGGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15648
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Essential Splice Site 1266 1349 31 33
Genomic Location (Zv9):
Chromosome 16 (position 5837583)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5063507
GRCz11 16 4892665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTARTTCTGCCAGTATWAACCCCACTAGCGCTACTAAATCAGCATCYG[T/A]AGGTCATTCATGACAGCWGTGCTCRTGTTGTCYTAACTTGCTTGAGCTGG
Long Flanking Sequence:
GGAACCAGTCACCTTCTTAGGCAAGACAAGGCAAGTTTATTTATATAGCACATTTCATACACAATGGCAATTCAAAGTGCTTTACATAAACAAGAATAAAAGAAACAAGTAAAATTAAAATAAAAAATGATCTTACTGATCATGCTACCCACTGTGCCACCGTGACACCTATCCAAGGCTCAAAAAACCTCATTCTTCAGTGCTGAAGTGCGCTCGCTTTTGCGATTTAGCTGTAGAACTTCTGATTCAGTTGCCGACTGGAGAAATGACCCGGGAAAATAAACAACAGAAAACGGTCTAGCTACTTGCTCTACAAACAAGTGTGTTTATGACTATACGTACACATAGAATAATATAATAAGAAAATATCCATTGCAGCTTAACAAGCTGACAAAAAATACAGAATAATAAAACTGACCCAACTTCAACATCAACTTTCATTTTCTTTTCTTTTAATTCTGCCAGTATTAACCCCACTAGCGCTACTAAATCAGCATCTG[T/A]AGGTCATTCATGACAGCTGTGCTCGTGTTGTCTTAACTTGCTTGAGCTGGTTTGATCATTGTTTATTTACTCAAAGCCAGTGTCAGGAGCAGTTTGTCTGATTCAGGGTGTGATGTTGAGTGTGTGCGCGAGTGTTTTCTGTCGGCTCTGTTCTGTAGGTGTGTGTGTGTGCCGTAAAGCCTCATGTTTCTGACTCCAGCACTCTGAATATTTATCATCAGTTCTACTGGCCGCCTCTGATTGTAATCTCTATTGATAAGGGCAAACTTTGTCACAAACACTCTCATCCCGGCGGCTCCACGTCATCTGTGTTTATGAGCTCTAGCTGAGCACACTAGAGAAAGTCACTTGCGCATCGCTGTTTTGAAGTCAGCTGCTTTAGTTTCAGATTTAAATTTTTATCGTTGACTTTAAAAAAATATATAGAATTTACTTATTTACTTATATTTATATTCTTATATATTTACTTTTTTTTGCTTATTTACTTAGTAAAAATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Nonsense 1336 1349 33 33
Genomic Location (Zv9):
Chromosome 16 (position 5840396)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5066320
GRCz11 16 4895478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATTACAACGCATTTAACAAYCCAGATGAGCTGATACTRGTGGAGAGGK[C/A]AGATCAAGGCCCAGTSGCCACCCCRACCTGGAACAAACACTGAACCCTCA
Long Flanking Sequence:
TTCAAGTATTTTCCAAAATATGTTTGATGGAGCAAGGGATTTTTCACAGTATAATATTTTTTCTTCTAGAGAAAGTCTTATTTGTTTTATTTCTGCAAGAATAAAAGCAGTTTTATTTAAAAAATAAATAAATAAATTTAATCATTATACAATGATTGCCTAATAAATTTAACCTGCCTAATTATCCTAGTTAAGCCTTTAAATGTTGAATACTAGTTTCTTGAAATATATTGAAATATAAAAGATAAAGGAAGTGAGTTATTTAAAATGAGTTATTAAAACTATGAGTTTTAGAAATGTGTTGAAAAAATCTTCTCTCCGTTAAACAGAAATTAGGGAAAAAATATACAGGGGGTCTAATAATTCTGACTTCAACTGTCTGTTTCCTATGTTGACCTTTTTTTCATCTGTATGATAGATTGAAGAACGAGCCGTTCAGGACCTGTTAATCCATTACAACGCATTTAACAACCCAGATGAGCTGATACTGGTGGAGAGGT[C/A]AGATCAAGGCCCAGTCGCCACCCCGACCTGGAACAAACACTGAACCCTCACAGTAACCATCACACTTACACCTAGGATTACAGCAGTATTCATCTGTGTCAATCTGAGTTCTGTTTCCCAACATTGTTCTGCATTAGCCACACTCGTTTAACTCTACTGCTTTAACTCTGCTGTTTCCTCTTGAGAATATGAAAGAGAAACTCTGGAGAGTCGCCACATGTGCCAAAATATGTTTGCTGCATCGTTTCTCTCTTTATTTTTTTATGATCCAGTGGTTTAATGATCTGCATCTCACAGGTAGTGTGTGTTTTTTTGCAGATTTAACACGCATATCGCTACGAATCGGTGTTAATTTTGTCAATGAAAATAAGGTGGCAAAACGTTCGCTTATAGCTTAACACATACAGGTCATTTGCACTAGACGCGGTCACCGATCTGCTTATTTAATGAATGAACAAGGTTATTGTTGACGATAAACAGATAAAAAGACTAAAATGTAG
Associated Phenotype:
Not determined