Busch Lab

ZMP

zgc:171482

Ensembl ID:
ENSDARG00000074415
ZFIN ID:
ZDB-GENE-080204-84
Description:
hypothetical protein LOC796610 [Source:RefSeq peptide;Acc:NP_001121744]
Human Orthologue:
ZMAT4
Human Description:
zinc finger, matrin-type 4 [Source:HGNC Symbol;Acc:25844]
Mouse Orthologue:
Zmat4
Mouse Description:
zinc finger, matrin type 4 Gene [Source:MGI Symbol;Acc:MGI:2443497]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28183
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111012 None None 134 None 4
ENSDART00000115089 Nonsense 221 254 6 7
ENSDART00000138981 None None 134 None 5
ENSDART00000141645 Nonsense 54 78 2 2
ENSDART00000145218 Nonsense 129 153 3 3
Genomic Location (Zv9):
Chromosome 13 (position 40263329)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39577220
GRCz11 13 39703110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTATTTTTTTTACTTTTATTTTTGTGTTGCAGGCCTGCGCCGCAGTTA[C/A]TCATGCAGTGTTTGTAACGTGGTCCTCAACTCTATCGAGCAGTATCACGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28182
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111012 None None 134 None 4
ENSDART00000115089 Nonsense 244 254 6 7
ENSDART00000138981 None None 134 None 5
ENSDART00000141645 Nonsense 77 78 2 2
ENSDART00000145218 Nonsense 152 153 3 3
Genomic Location (Zv9):
Chromosome 13 (position 40263262)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39577153
GRCz11 13 39703043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTGGTCCTCAACTCTATCGAGCAGTATCACGCACATCTCCAGGGCTCC[A/T]AACACCAAAACAAGTGAGTGTGAATTTTCTGTTATGAACTTTCATCCATG
Associated Phenotype:
Not determined