Busch Lab

ZMP

LOC100332329

Ensembl ID:
ENSDARG00000074413
Human Orthologue:
MYO9B
Human Description:
myosin IXB [Source:HGNC Symbol;Acc:7609]
Mouse Orthologue:
Myo9b
Mouse Description:
myosin IXb Gene [Source:MGI Symbol;Acc:MGI:106624]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa30432 Nonsense Mutation detected in F1 DNA Not yet available
sa30430 Nonsense Mutation detected in F1 DNA Not yet available
sa30429 Nonsense Mutation detected in F1 DNA Not yet available
sa30428 Nonsense Mutation detected in F1 DNA Not yet available
sa30754 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30432
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 392 1825 11 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 155958)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5010844
GRCz11 22 5395219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACATGCGGCCGGATATCGTGGCTCTCTTGCGGAGCAGTGACCGGTTTTA[T/A]GTCCGCCAGCTGATCGGGATGGACCCGGTGGCCATGTTTCGATGGGGGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30431
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 474 1825 13 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 150389)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5016070
GRCz11 22 5400445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCTGAATCAGGGACATGCATGCACAAATCATCAACTCCATTAAGGACT[T/A]GCAGTTGGATGGAGAAGATCCACGTAAGCTGCTGCAGTCCTGGGGTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30430
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 856 1825 22 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 146330)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5020129
GRCz11 22 5404504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCAAACTTCCACCATCGAGAAGTCTGGAGAAACGGGAGCTTAGGAGA[C/T]AACGTGGCCTAGAGCATAACCAGAGAGAAAGTGAACGAGCAGCTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30429
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 1374 1825 36 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 132058)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5034401
GRCz11 22 5418776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATTAAAGATATACTGTTGTTTGTGTGCTGTGGATCTAGTGTGAAGAT[G/T]AGCCTGGATCCAATCACTTTGGTGTACGCGTCGGCAACCTGGTCAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30428
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 1483 1825 38 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 129433)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5037026
GRCz11 22 5421401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTTGTTAGAACTTCTGTTGTCTTTCTGCCGCAGAACTACCTGAGAAG[C/T]AAGAGCAATTGCAAGCGATTTACAGAGTTTTGGAGCAGCTGCCGACGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30754
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Essential Splice Site 1615 1825 42 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 124005)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5042454
GRCz11 22 5426829
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTCAGTTTTGTTACCTTGAGTTAAAGTTGGTATTTGTTTGGACTCTA[G/A]ATTCGGGAAAAGCCATCTTCTGACCTTTGTGTTGTACCTGAGAACGAGCC
Associated Phenotype:
Not determined