Busch Lab

ZMP

CDH12 (2 of 2)

Ensembl ID:
ENSDARG00000074386
Description:
cadherin 12, type 2 (N-cadherin 2) [Source:HGNC Symbol;Acc:1751]
Human Orthologue:
CDH12
Human Description:
cadherin 12, type 2 (N-cadherin 2) [Source:HGNC Symbol;Acc:1751]
Mouse Orthologue:
Cdh12
Mouse Description:
cadherin 12 Gene [Source:MGI Symbol;Acc:MGI:109503]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22165 Nonsense Available for shipment Available now
sa22166 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22165
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087449 Nonsense 101 718 2 16
Genomic Location (Zv9):
Chromosome 12 (position 42124318)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 40225615
GRCz11 12 40398622
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGCAGTTTAACAAAAACGAATGTACTCTGTCTATTTGCAGGTACGTA[T/A]GTGATGAAGGTGACGGCAACAGACGCAGATGACCCTACATATGGAAATAG
Long Flanking Sequence:
AAGTATTTTTGAAAACTATTTCTACAGAGGAAATAAAAGGAGTCGTTTCTATAAAAGGAGTCGTTTCTATAATACGCCAGAGCGACAACACATCATTCTTGCAAAATGGTGAGATGGTCAAAGCACCGTATTCTGCTGCATTTCATAAAAACACAGCGTTTCAGCAGCCCATGACCATCAGCTCATTCTACAGTATGGACCATTTGTCATTTATTGGGTAATCTAAAAGTGCTGCCTTTGTATTGTAAAAACTGTCATCAAAATACAGTGGAAAATCAGTACATTGCCATCTGCTAGGCTTTATATCAGTCCGCTCATAACCCATTCCATATAATGATGTGCCTGTTTTCTAGTCCCAGTCAAACCCTACATTTAATCTAAAGGCCGAACCATGAGCTATTACAGTAATAACCTTGAACAAAGCACGTCTTGCACATTTTCTCTATCTATTCATGCAGTTTAACAAAAACGAATGTACTCTGTCTATTTGCAGGTACGTA[T/A]GTGATGAAGGTGACGGCAACAGACGCAGATGACCCTACATATGGAAATAGTGCCAGAGTCGTGTACAGCATTTTGCATGGCCAGCCGTATTTCTCCGTGGACCCCAAAACAGGTAAAGCAACTCTGAAATATGGGTAGTTGACAAGTAGATAGTGGTTTTATTTTATTTTATTTTATTATAAAATATATAGATATTATATTATATTTTATTATATTATATATTTATTTATTTAATTATGTAGTCTGAAATCTGACTGTTTGGGTAAACATGTGGGGTCACAAACATTTAAGAAAATATAAGGAATCACAATTTTTTGAGAAAATATGAGGGGCTGCAAACTTTTGAGAAAATATACAGGGTCGCAAACATTTGAGAGAATATATGAGGTCACAAACCTTTGAGAAAATATAAGAAGTTTCAACGATTCAGAAAATATAAGGGGTTGCACAATAAAAAAAATGAATGGGGTCACAAGCTTTTAAGAAAATATAAAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2631
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087449 Nonsense 215 718 4 16
Genomic Location (Zv9):
Chromosome 12 (position 42146558)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 40247855
GRCz11 12 40420542
KASP Assay ID:
554-2574.1 (used for ordering genotyping assays)
KASP Sequence:
ACCTGCGTGTACYGGAGTCWTCAGCAGTCGGCTCAGCGGKCGGCAGAATC[A/T]AAGCTCATGATCTGGACATTGGGAAGAACGCCGAGGTCGAATACAACATC
Long Flanking Sequence:
AATTCTTTAAAATGTTTTTAATATTTCTCAAATGATGCTTAACAGGGCAAGGAGATTTTTGAAAATGGGAAAAATATAAACAAGGGGTCTAATAATTCAGGGTGGCTAATAATTCTGACTTCAACTGTATATGTGAGCGCAAATTCCCACACGAGCTAATGCTTTCGTTCACAACTATTTTATATAAGTTACAGCATCCAGGATAGTTTTGATGAACTATATAATTCTTCATTCTCTCTTTTCATTGTAAACAAGCCTAAATGCACACTTTAAAAACCCTGATGTAAGCTGGAGTGAATAAATTAACAGCAAAGATCCATTTAATAGTAAACATCCTATTTAATGTCAGCAGTGCATTTAAGCTTGTTATCCTAAAAATGAACAGAATTCCCCAGCACTGCTATACACATGTGCTTGAAGAGATGCTCATATATTCTGCAGGCATCTTTCACCTGCGTGTACCGGAGTCATCAGCAGTCGGCTCAGCGGTCGGCAGAATC[A/T]AAGCTCATGATCTGGACATTGGGAAGAACGCCGAGGTCGAATACAACATCGTCCCTGGAGATGGAGGAGCCATGTTTGATATCACCACCAACGAGCACAATCAAGAGGGGATCATCATGCTTAAAAAGGTACATTGCAATCTGTATTAACTACAATGCTGATTTCTGGCAACGTGTAATGTAATGTGCATTTAGAGTGAAGGAAATAAGTATAAGTAACATGTCAGGATGAGAATGGAGAATGAAGTCACATGCATTGCTCACATGCATTGCTCAGGTGTGATTTTCTTTCACAGACTACCACAGAGTGTAAAAATTTTGATGGTTCTGTGGGTCTCGTCTATCACATCTGATCTTTATTTAGTATTCTCTATTGGATTTAAGTCGGGTGATTGGTTGGGCCATTCTACAGCTTGATTTTCTTTCTCTGAAAGCATTTGAGCTTTCTATGTTTTGGATCATTGTCTTGCTGAAATGTCCACCCTGGGTTCATCTTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22166
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087449 Nonsense 566 718 16 16
Genomic Location (Zv9):
Chromosome 12 (position 42244163)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 40345135
GRCz11 12 40517789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTGTGTTTCTTGCAGTGATCGTGGTGCTCTACGTGGGGGTTCGGCGA[C/T]AAAAGAAGAAAGAGACCCTCATGACATCCAAAGAGGACATCCGTGACAAT
Long Flanking Sequence:
CTGTTTTAGGGGGAAAAAGATGTGCTAAAAAAGAGATGTTTCTCTATTGCAATTGAAAAAGATTTTCTTTACAAAAACATTCATCAATTGAACAACAAAAAACAGTCAGGCCGTTTCGCAACTGATCATACACTTTTTTTCTAGTTTACACAGAGACAATAAAAAAAGCATGCACCTAATCCCTAATCCTAAACATTACCTAAAATTAAGTATGACCTTGCTTACTATAATTAAATTTACTAAGACAAAAATCTTAGGTTTTGGTTCATTAATAGTGACAACTGAATGAATAAAGACAAAAGATTGTATGTTTTGTTCTGTTCTTTGTGTTGCAAACACCTTCCTATGTTTCATTGGCTCTTCAGAGTCTTCATTGTCATACATTCTAATAACATCTTTAATCTTTCTTATAATGTTAATAATATGGATCATAAAAAAGCTAAACGTCCTCTGTTGTGTTTCTTGCAGTGATCGTGGTGCTCTACGTGGGGGTTCGGCGA[C/T]AAAAGAAGAAAGAGACCCTCATGACATCCAAAGAGGACATCCGTGACAATGTCATCCATTACGATGATGAAGGAGGAGGCGAAGAGGATACGCACGCATTCGACATGGGCACCCTTCGCAACCCCAAAGTCATCAAGGAAAACCTGTTTCGCCGAGACGTCAAGCCAGAGCTGGGATTGTGTCCGCGTCGGCCAATCGGCTCACAGAACAGCAACGACATCAGCAACTTCATCAGTCAGCGTCTGCAGGAGCACGATGGAGACACGTCCGCACCACCATATGATTCGCTGGCCACTTACGCCTATGAGGGTGAGGGTTCGGTGGCTGAAAGTTTGAGCTCTATAGAGTCCGTAAAAGGGGAAACAGAAGAGGACTATGATTACCTCAACGAGTGGGGGCCTCGCTTCAAAACCCTCGCAGGGATATTTGGAGAACGATCAGAGAGCCAATCAGATGTAACATCCAGCTCCGCCACCGAAAACAAACACTGATGTTGCTTT
Associated Phenotype:
Not determined