Busch Lab

ZMP

si:ch211-235f1.1

Ensembl ID:
ENSDARG00000074381
ZFIN IDs:
ZDB-GENE-050522-234, ZDB-GENE-070424-163
Description:
Novel protein similar to vertebrate FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (Chondrocy
Human Orthologue:
FARP1
Human Description:
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Farp1
Mouse Description:
FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) Gene [Source:MGI Symbol;

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa38239 Nonsense Mutation detected in F1 DNA Not yet available
sa39532 Nonsense Mutation detected in F1 DNA Not yet available
sa25509 Nonsense Mutation detected in F1 DNA Not yet available
sa9536 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38239
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 None None 1033 None 26
ENSDART00000108919 Nonsense 100 141 3 3
ENSDART00000142944 None None 1025 None 27
ENSDART00000143361 None None 811 None 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2151427)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2246847
GRCz11 1 2394641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGAGTTTCAGGATCAGCGGAAAATGATTGTGAGCAACGCTTGTCTTT[T/A]ATTTCAATATGTGAAACATGAGCTACCTCTATACACACAGTACTCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39532
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 Nonsense 104 1033 3 26
ENSDART00000108919 None None 141 3 3
ENSDART00000142944 Nonsense 104 1025 4 27
ENSDART00000143361 Nonsense 104 811 4 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2151758)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2247178
GRCz11 1 2394972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTTGATTCTCTTCTCAGGTGTGGCTGGATCTGCTGAAGCCAATTCTC[A/T]AGCAGATTAGACGTGAGTATACATGTCTGAGTGTTGTTCTGACTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25509
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 Nonsense 506 1033 13 26
ENSDART00000108919 None None 141 None 3
ENSDART00000142944 Nonsense 502 1025 14 27
ENSDART00000143361 None None 811 None 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2177207)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2272627
GRCz11 1 2420421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGTCCTGACGGACGGCAGCCCTCTCCTCTCACCAGCCCGCTACTATA[C/A]GACGCCGGATTCATCCGCGCAGACGACGAGGACGAGGTTCGGAGGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9536
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 Essential Splice Site 771 1033 20 26
ENSDART00000108919 None None 141 None 3
ENSDART00000142944 Essential Splice Site 763 1025 21 27
ENSDART00000143361 None None 811 None 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2188925)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2284345
GRCz11 1 2432139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATYACTTGACCTTGTCAATCTGTATGTTCACTTGATGTGTTTGTGTGCA[G/A]TTCAGTGATGTTGTGATGTACACGAGTCGAGGATTGACGGCGTCCAATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7892
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 Nonsense 871 1033 23 26
ENSDART00000108919 None None 141 None 3
ENSDART00000142944 Nonsense 863 1025 24 27
ENSDART00000143361 None None 811 None 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2193031)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2288451
GRCz11 1 2436245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TNCCATGTTAAACTKTGTTCCTYCACATCTCTCAGAGTCTCCTGAAGACTG[T/A]AGYGCAGACCAGGAGTCAGAAGACGACCTCAGCTCCTCTCGATCCTCTCT
Associated Phenotype:
Not determined