Busch Lab

ZMP

MDGA1

Ensembl ID:
ENSDARG00000074376
Description:
MAM domain containing glycosylphosphatidylinositol anchor 1 [Source:HGNC Symbol;Acc:19267]
Human Orthologue:
MDGA1
Human Description:
MAM domain containing glycosylphosphatidylinositol anchor 1 [Source:HGNC Symbol;Acc:19267]
Mouse Orthologue:
Mdga1
Mouse Description:
MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa44795 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14556 Essential Splice Site Available for shipment Available now
sa19070 Nonsense Mutation detected in F1 DNA Not yet available
sa11282 Nonsense Available for shipment Available now
sa22373 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44795
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Essential Splice Site 193 756 4 11
Genomic Location (Zv9):
Chromosome 13 (position 45036237)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44279736
GRCz11 13 44416640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGAGCAAAGACAACGGCGTGGACATCTATGAGCCTCTGTACACACAGG[T/C]ACAACATACAAATTTGTCTTTGTGTCATGATTTATGATGGTTATATATGA
Long Flanking Sequence:
AGTTTTCAATTTTGTGCGAAAGTATTAGTTCATTAGTTCTTTAGTGGACGCATCGATTCTCAGAATTTGACTATGAGTTGGCAAAGCAGTCGTTCAGATCTCACTGTAATGGTGCAGATAATGTGGTGAAGGTACTGTAATCTCCACCTGCAGAACACTGGAAATAGCCATCTTGTTAGTGACCATGAGATCAAGATAATTGTGAGTTCAGAGAGCATTTACCTCTCAGATTGCTCCATTAAAAAGACTACATTTTCCAGTGTAAGTCAATTCTCTTTTTCCTTTCTTTTTGTGTCCTGCAGATCTGGATAAGCCTGTGCTCACGGTGCACCAGACGGTTGGTGATGTAAGAGGAAACTACTATCAGGAAAAAACAGTGTTTTTACGCTGTACAGTGAACTCCAACCCTCCTGCTCGCTTCATCTGGCAACGAGCAAACAATCCAATCGAACAGAGCAAAGACAACGGCGTGGACATCTATGAGCCTCTGTACACACAGG[T/C]ACAACATACAAATTTGTCTTTGTGTCATGATTTATGATGGTTATATATGAAGATGGTTATGTCTTTTAGACCCTAACTTTACACCTGAAGCATACAGAATCACCATCATCATCATCATCATCCTTATATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAGCGGTTCATTCCGCTGTGGCGACCCCAGATTAATAAAAGGACCAAGCCAAATAGAAAATGAATAAGTGAATGAATAATAATATATTTTTTGATTTATTTAGTTATTTGTTTATTAATCATTCATAATGTAATAAATATAAATATTGTATTATTTTTCTATATTGTAATATTTCTATAATAATTTATTTATTACAATATTTAGTAGGTTTAACATTTGTTGTTTGGCAAGTTATTTATTTATTTATTTATTTATTTATTCTTATCATTTTTGTTGTTGTTAGTAGTAGTGGTAGTAGTAGTAATATGACCATTAGGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14556
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Essential Splice Site 537 756 8 11
Genomic Location (Zv9):
Chromosome 13 (position 44974778)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44218277
GRCz11 13 44355181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCCTCAATATTAAACGCAGACTGGCTCAGGTGCAGCTCAACGTGGAGTG[T/A]AAGTGTTTTAAATTGCTACTAGACCAATCTTAAAGTAGYTGGTTATAAAT
Long Flanking Sequence:
ATTAATTCGGGGTGGCCACAGCAGATTGAACTGCCAACTTATCCAGCATGTTTTTACGCGGCGGTTGCCCTTCTAGCCGCAACCCATCTCTGGGAAATACTATATATATATACATACAAATATAAATTATTCTTATATTATTTATTTACAGTCATCCAAATACAGTGTCCGTCCACTTATGTGTCCTTTTCTTGTTTTCCAGTCGTTCCTCCGGTGCTGAGCGTGCCAGTCGGAGGGGGTGTGGTCAATGTCAGTGAGGGCGGGACTGCAGAACTTGTGTGTTTGGTTGATGGCAAGCCCCGCCCCCCTGTCCTGTGGTCCCGTGCGAACAAAGACCTGCCCATGCCGTCAGGTGATTGGATGGTGGAAACCCGTGACGGACGCCTGCGCATTACCAGTGTGACGCGAGACATGATGGGAGCATATCGCTGCCAAACCGCACCATACAATGGCCTCAATATTAAACGCAGACTGGCTCAGGTGCAGCTCAACGTGGAGTG[T/A]AAGTGTTTTAAATTGCTACTAGACCAATCTTAAAGTAGCTGGTTATAAATTAAAAATTATTAAACAGCATTTTTCCCCACAGATCTGCATCAATTATAACATTCTCAGTTTCCTGCTTTTCCAGTTGTTGGATAAACTACACTGTGATTACTTAAAATTATTACCAGTCAAATGAGAAACTGAGGCAAAGGGCCTTATCATGCACCTAGCAATATAAGCTGCAAGACGTGTTTGGTGTGATTTGTTGCTTTTTTCAGACCAGCGCAACTGTAATTTTCATGTTTTGCGCCACATTGTTTAAATAGCAAATCCATTTGTGCCACTTTGTGAAATCATGGGTGTGCTTGTCTATAAAGGAGGTGTGTTAAGGCGCATCAATGTGTTGCTATTTTGAGGAACTGAAATAGACCATGCCATTAAACAACTGAAAGCAGGTCTAAAGCACAGATTGTGTTAGCTATGTGGCTATGAGGGTCCAAAACGCGTAGACATTGCTTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4533
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Essential Splice Site 537 756 9 11
Genomic Location (Zv9):
Chromosome 13 (position 44960078)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44203577
GRCz11 13 44340481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATAAACTYAACAWGTAAACAAGCAGTCTAATAKTCTTTTTGTTTTCACC[A/T]GATCCTCCTGTTGTGGATCCAGTAATGATGGATGTTCGTTCTCCAACATT
Long Flanking Sequence:
CTCCAAAACTGATGCAATTAATGTAAAATTATAATTGTACATTAAATATAAAGTTGATTTCTATTAAAAAAAGCATAATAACGCAAAAAAACTTTGCTTTAAACACATAAATATACTTTTTTTTTAGATGTACAAAATTAGTTTGTGTTGGCCAAGATTTTAACACAGAAGAAATTATCATCTGCTTTTTTTTCAAATTGATTTTTCTTCATTATAATAGGATGTCAATCAAGATTCAAATAATTTCTGGGACCCCAAAAGAAGCAGATTTCAACCCTAAATTCATTTTTTTCCAGTATTTGAATGAGTACTTGAGAGTCTACTCATGAAATAATGAGAGTTTTTCCAATGTGTATATCTTCAACACATCATACCAAAACTGATGCAACTGATATGAAATGTCTGCAAAATTATAAAAGTACCGAAATATTCACCACACAAATGTAAACTCATAAACTTAACATGTAAACAAGCAGTCTAATATTCTTTTTGTTTTCACC[A/T]GATCCTCCTGTTGTGGATCCAGTAATGATGGATGTTCGTTCTCCAACATTTGCGACGGTCAGTCTCCGCTGTCTGATTCTCAAGTCCAATCCAAACCGAATAGTCAGCGCCTACTGGTACCGTAATGGAATACCTTTACGAAACTCTCTAGTGGACTCCCAAAATGTCCCTCAGCTCCGCTTCAAACTGGACACCACCAATAACGGCACGTATGAGTGCAGGGTGAGCAATGGAGTCGGCATCTCAAACTGCACCTTCAATGTTTCTGGTGAGTTTTTACTGGGACTTTTCTTATGCACTGTATGTTAAGAGAAATAAACCTTTAAAAAAGATAAGTATTCGGGGAGAATGATCATCATGCTATACTTACCTCTCTAATGAAAATAATGTCCATCTTGTTGCATCTGTTGTACCAGTGTTGGGTTAAAGCATTATTTTACAAGTAACACGCTACGTTAGAATATTTCTTTTCTAAATGAACTAAAGTAATGTATTACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19070
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Nonsense 569 756 9 11
Genomic Location (Zv9):
Chromosome 13 (position 44959981)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44203480
GRCz11 13 44340384
KASP Assay ID:
2260-6916.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTGCGACGGTCAGTCTCCGCTGTCTGATTCTCAAGTCCAATCCAAAC[C/T]GAATAGTCAGCGCCTACTGGTACCGTAATGGAATACCTTTACGAAACTCT
Long Flanking Sequence:
TTTAAACACATAAATATACTTTTTTTTTAGATGTACAAAATTAGTTTGTGTTGGCCAAGATTTTAACACAGAAGAAATTATCATCTGCTTTTTTTTCAAATTGATTTTTCTTCATTATAATAGGATGTCAATCAAGATTCAAATAATTTCTGGGACCCCAAAAGAAGCAGATTTCAACCCTAAATTCATTTTTTTCCAGTATTTGAATGAGTACTTGAGAGTCTACTCATGAAATAATGAGAGTTTTTCCAATGTGTATATCTTCAACACATCATACCAAAACTGATGCAACTGATATGAAATGTCTGCAAAATTATAAAAGTACCGAAATATTCACCACACAAATGTAAACTCATAAACTTAACATGTAAACAAGCAGTCTAATATTCTTTTTGTTTTCACCAGATCCTCCTGTTGTGGATCCAGTAATGATGGATGTTCGTTCTCCAACATTTGCGACGGTCAGTCTCCGCTGTCTGATTCTCAAGTCCAATCCAAAC[C/T]GAATAGTCAGCGCCTACTGGTACCGTAATGGAATACCTTTACGAAACTCTCTAGTGGACTCCCAAAATGTCCCTCAGCTCCGCTTCAAACTGGACACCACCAATAACGGCACGTATGAGTGCAGGGTGAGCAATGGAGTCGGCATCTCAAACTGCACCTTCAATGTTTCTGGTGAGTTTTTACTGGGACTTTTCTTATGCACTGTATGTTAAGAGAAATAAACCTTTAAAAAAGATAAGTATTCGGGGAGAATGATCATCATGCTATACTTACCTCTCTAATGAAAATAATGTCCATCTTGTTGCATCTGTTGTACCAGTGTTGGGTTAAAGCATTATTTTACAAGTAACACGCTACGTTAGAATATTTCTTTTCTAAATGAACTAAAGTAATGTATTACTAATAGATTTATGTGAATAACTACAAAAATCCTAAAGAACATATACAGGCAAAACTAAAGTAATACCAGTGAATGGTATTAGTGATGTCTTGTGGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11282
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Nonsense 583 756 9 11
Genomic Location (Zv9):
Chromosome 13 (position 44959939)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44203438
GRCz11 13 44340342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCMAACCGAATAGTCAGCGCCTACTGGTACCGYAATGGAAWACCTTTA[C/T]GMAACTCTCTAGTGGACTCCCAAAATGTCCCTCAGCTCCGCTTCAAAYTG
Long Flanking Sequence:
AGTTTGTGTTGGCCAAGATTTTAACACAGAAGAAATTATCATCTGCTTTTTTTTCAAATTGATTTTTCTTCATTATAATAGGATGTCAATCAAGATTCAAATAATTTCTGGGACCCCAAAAGAAGCAGATTTCAACCCTAAATTCATTTTTTTCCAGTATTTGAATGAGTACTTGAGAGTCTACTCATGAAATAATGAGAGTTTTTCCAATGTGTATATCTTCAACACATCATACCAAAACTGATGCAACTGATATGAAATGTCTGCAAAATTATAAAAGTACCGAAATATTCACCACACAAATGTAAACTCATAAACTTAACATGTAAACAAGCAGTCTAATATTCTTTTTGTTTTCACCAGATCCTCCTGTTGTGGATCCAGTAATGATGGATGTTCGTTCTCCAACATTTGCGACGGTCAGTCTCCGCTGTCTGATTCTCAAGTCCAATCCAAACCGAATAGTCAGCGCCTACTGGTACCGTAATGGAATACCTTTA[C/T]GAAACTCTCTAGTGGACTCCCAAAATGTCCCTCAGCTCCGCTTCAAACTGGACACCACCAATAACGGCACGTATGAGTGCAGGGTGAGCAATGGAGTCGGCATCTCAAACTGCACCTTCAATGTTTCTGGTGAGTTTTTACTGGGACTTTTCTTATGCACTGTATGTTAAGAGAAATAAACCTTTAAAAAAGATAAGTATTCGGGGAGAATGATCATCATGCTATACTTACCTCTCTAATGAAAATAATGTCCATCTTGTTGCATCTGTTGTACCAGTGTTGGGTTAAAGCATTATTTTACAAGTAACACGCTACGTTAGAATATTTCTTTTCTAAATGAACTAAAGTAATGTATTACTAATAGATTTATGTGAATAACTACAAAAATCCTAAAGAACATATACAGGCAAAACTAAAGTAATACCAGTGAATGGTATTAGTGATGTCTTGTGGAGCAAAATGAGTGATCTTTGCTGGAAATATTCTTTACAACTGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22373
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Nonsense 674 756 10 11
Genomic Location (Zv9):
Chromosome 13 (position 44947999)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44191498
GRCz11 13 44328402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGCCCGGCGCTGTGGACAAAATCATCGGCTACTGGATCAATGTCCGA[C/T]AGGTACACACACACACCAACGCTGGAAGCTTAATATTTACTGCTTCTTTC
Long Flanking Sequence:
CAGCGTGGTGCAAAACGTCAAAACGACTCTTCAACCAAGCTGACACTAGCCAACAATTGTGTCGCGCCTTATGCCGTATTGCGCCGGGTGTATGATAGGGCATAATTTCATCGAACTACACGTTTGTTTGTTGCAAATCCTCCCCCTTTAGTGGCGAAAATCACATATTTTGCATTCAGTCCACTTTCTTCTAGCAATTTAACGAAGTTATATCTAATAAATGAGAAGTATTGTATATCCATGTACATTAGCTTACTCTCACATTGAAAAGCAATGAGCTTAAGATGGTGGCAATTCATCATATTCAAGCATTTGTTTAATTAGTCATGCTCTCTTTCACTTTGTTTGTTCTTTCAGCTCAGCCGTACGATGCGGAATTTTACTACGACACTCCAAATCCCATTCGCACCTTGAAGAACAATTATTCCTACATCTTACAGTGGACCCAGAAAGAGCCCGGCGCTGTGGACAAAATCATCGGCTACTGGATCAATGTCCGA[C/T]AGGTACACACACACACCAACGCTGGAAGCTTAATATTTACTGCTTCTTTCCATCCTCCTTCCGTTTGTCCATTCTTTCTTTCTCCGTGGTTGACTCGGTGGGAGGTGGATGAGTAGAATAAGTGTGTTTGTAATAGGAGTCAGGGGAATAGTGTGCTCTATGTAGGGAGCAGACAGCGGATCGATCGCTGCTTGTACTGCATTAAAGAGACTCTCAGAACCCCACCGGCCCAACACAAGAACACAGAAGCAGCCTGATTGGGTCTGTATTTCATCCCTTCTGGGGGACAAAAAAGCCCATACACCCTAAGGTGGTTAAACCTTCACATTGGTCAACCACAGTGTGATAAACAACCAGCTTGGATTAAAATGCAATGTTGCTAAAGGCCATTCTGAGTGCACGATTTTTCATTGTCATTGATGAAGTAAAATCGACCTTTAGTTTTGACCTCTTTGGACAAAATATGGGTGTTGGCATGAATAAATGGCGATTTAAGGTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28196
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Essential Splice Site 674 756 10 11
Genomic Location (Zv9):
Chromosome 13 (position 44947995)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44191494
GRCz11 13 44328398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCGGCGCTGTGGACAAAATCATCGGCTACTGGATCAATGTCCGACAGG[T/C]ACACACACACACCAACGCTGGAAGCTTAATATTTACTGCTTCTTTCCATC
Long Flanking Sequence:
GTGGTGCAAAACGTCAAAACGACTCTTCAACCAAGCTGACACTAGCCAACAATTGTGTCGCGCCTTATGCCGTATTGCGCCGGGTGTATGATAGGGCATAATTTCATCGAACTACACGTTTGTTTGTTGCAAATCCTCCCCCTTTAGTGGCGAAAATCACATATTTTGCATTCAGTCCACTTTCTTCTAGCAATTTAACGAAGTTATATCTAATAAATGAGAAGTATTGTATATCCATGTACATTAGCTTACTCTCACATTGAAAAGCAATGAGCTTAAGATGGTGGCAATTCATCATATTCAAGCATTTGTTTAATTAGTCATGCTCTCTTTCACTTTGTTTGTTCTTTCAGCTCAGCCGTACGATGCGGAATTTTACTACGACACTCCAAATCCCATTCGCACCTTGAAGAACAATTATTCCTACATCTTACAGTGGACCCAGAAAGAGCCCGGCGCTGTGGACAAAATCATCGGCTACTGGATCAATGTCCGACAGG[T/C]ACACACACACACCAACGCTGGAAGCTTAATATTTACTGCTTCTTTCCATCCTCCTTCCGTTTGTCCATTCTTTCTTTCTCCGTGGTTGACTCGGTGGGAGGTGGATGAGTAGAATAAGTGTGTTTGTAATAGGAGTCAGGGGAATAGTGTGCTCTATGTAGGGAGCAGACAGCGGATCGATCGCTGCTTGTACTGCATTAAAGAGACTCTCAGAACCCCACCGGCCCAACACAAGAACACAGAAGCAGCCTGATTGGGTCTGTATTTCATCCCTTCTGGGGGACAAAAAAGCCCATACACCCTAAGGTGGTTAAACCTTCACATTGGTCAACCACAGTGTGATAAACAACCAGCTTGGATTAAAATGCAATGTTGCTAAAGGCCATTCTGAGTGCACGATTTTTCATTGTCATTGATGAAGTAAAATCGACCTTTAGTTTTGACCTCTTTGGACAAAATATGGGTGTTGGCATGAATAAATGGCGATTTAAGGTTGCGTA
Associated Phenotype:
Not determined