Busch Lab

ZMP

tirap

Ensembl ID:
ENSDARG00000074371
ZFIN ID:
ZDB-GENE-040219-4
Description:
MyD88 adaptor-like protein [Source:UniProtKB/TrEMBL;Acc:Q6TQG3]
Human Orthologue:
TIRAP
Human Description:
toll-interleukin 1 receptor (TIR) domain containing adaptor protein [Source:HGNC Symbol;Acc:17192]
Mouse Orthologue:
Tirap
Mouse Description:
toll-interleukin 1 receptor (TIR) domain-containing adaptor protein Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa182 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa264
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109673 Nonsense 20 226 2 3
Genomic Location (Zv9):
Chromosome 18 (position 47496104)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48758929
GRCz11 18 48753716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATATTGAACTTCTTTACGTCAGGCTGGTTTCGTGAGCGTTTTGGCAGA[C/T]AAAGGAACGGACAGGAACAAATCAACCCATATGAAAACCCTCCTCCTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29101
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109673 Nonsense 89 226 2 3
Genomic Location (Zv9):
Chromosome 18 (position 47495896)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48758721
GRCz11 18 48753508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGACCTCTATCTGTGCCACTCCGAGAAGGACATGGAGCAGGCGCAGAGTT[T/A]GGCCACTTTCCTGGAGCAGCCGGGTAAAAGTCTGCGCTGTTTCCTGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa182
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109673 Nonsense 145 226 2 3
Genomic Location (Zv9):
Chromosome 18 (position 47495727)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48758552
GRCz11 18 48753339
KASP Assay ID:
554-0146.1 (used for ordering genotyping assays)
KASP Sequence:
TGGCTRCTGCTCATAACTCCACACTTTCTGAAGGATGATTGGTGTTTGTA[T/A]CAGATGCACCAGGTCCTGTCTGAGGGCCCGATGTCTCAGAGGATWATCCC
Associated Phenotype:
Not determined