Busch Lab

ZMP

LOC559878

Ensembl ID:
ENSDARG00000074367
Human Orthologue:
USP12
Human Description:
ubiquitin specific peptidase 12 [Source:HGNC Symbol;Acc:20485]
Mouse Orthologue:
Usp12
Mouse Description:
ubiquitin specific peptidase 12 Gene [Source:MGI Symbol;Acc:MGI:1270128]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30542
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114429 Nonsense 315 383 7 9
Genomic Location (Zv9):
Chromosome 7 (position 52796332)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51066082
GRCz11 7 51341152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTTTAACACCTCTGGGGATGCTACAAATCCTGACCGATTGTACGATT[T/A]GGTGGCTGTAGTGGTGCACTGTGGGAGGTAGGCTTCAGTGTTTATTATTT
Associated Phenotype:
Not determined