Busch Lab

ZMP

GDPD4 (2 of 3)

Ensembl ID:
ENSDARG00000074361
Description:
glycerophosphodiester phosphodiesterase domain containing 4 [Source:HGNC Symbol;Acc:24849]
Human Orthologue:
GDPD4
Human Description:
glycerophosphodiester phosphodiesterase domain containing 4 [Source:HGNC Symbol;Acc:24849]
Mouse Orthologue:
Gdpd4
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3606573]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36567 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36567
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113963 Nonsense 331 411 8 10
Genomic Location (Zv9):
Chromosome 18 (position 6694908)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3200745
GRCz11 18 3351825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTCTCTGCTTCCTTCACACAGACTCCAGATCAGTACAATCTGATGTG[G/A]ATCCTCACCATTATCGTCTCTGCTTTCTTCATCACCGCTGTTTTCATTTT
Associated Phenotype:
Not determined